Что можно на ночь на пп: Топ-10 продуктов, которые можно съесть перед сном без вреда для организма

Содержание

Топ-10 продуктов, которые можно съесть перед сном без вреда для организма

«Сколько людей — столько и мнений» — это выражение касается и специалистов в области правильного питания: часть утверждает, что есть на ночь, а еще лучше после 18 часов, запрещено, поскольку организм и так наработался за день, и это настоящее преступление — заставлять его работать, переваривая пищу еще и ночью. А есть и те, кто убеждает в необходимости перекуса на ночь, если организм действительно этого просит, иначе, спокойного качественного сна, столь важного для хорошего самочувствия и продуктивности в течении дня, можно не ждать.

Кто из них больше прав в своих убеждениях — сказать сложно, однако большинство все же склоняются к тому, что если организм действительно сам просит его «покормить», то за 2-3 часа до сна можно подкрепиться, главное — знать чем!

1. Кисломолочные продукты

Кефир, обезжиренный творог, натуральный йогурт или простокваша — ваши универсальные спасатели от приступов вечернего голода. Они состоят из легкого белка, который прекрасно усваивается организмом, насыщает, однако не перегружает его. Важно, чтобы порция не превышала 200-250гр. Можно добавить к кисломолочке ложечку меда, корицы или ванили, это только улучшит эффект. В результате — вы счастливы, сыты, лишних килограммов нет, и все довольны!

2. Теплое молоко

Большинству из нас родители в детстве перед сном давали выпить стакан теплого молока, и не просто так: в молоке содержится такая аминокислота как триптофан, которая успокаивает и помогает при бессоннице. Поэтому, лучше выпить на ночь немного молока, и на утро быть полным сил и энергии, чем пытаться потом пополнить их запас с помощью вредной пищи.

3. Яйца

Яичный желток, как известно, содержит в своем составе белок, жиры и холестерин, а яичный белок — это сочетание исключительно воды и легкоусвояемого белка в соотношении 90% к 10%. Поэтому, учитывая состав и калорийность желтка (352 ккал / 100г) на ночь можно позволить себе съесть или 2 целых яйца, или столько белка, сколько осилите, ведь его энергетическая стоимость всего 44 ккал / 100г. Но, учитывайте то, что белок немного дольше усваивается, поэтому фанатизм здесь также не приветствуется — «что за бардзо, то не здраво».

4. Грейпфрут

Грейпфрут по праву называют лучшим цитрусовым для похудения, так как у него низкий гликемический индекс, достаточно мала калорийность (35 ккал / 100г), он является источником ценной клетчатки, целого спектра различных витаминов, а также в его состав входит нарингин, что улучшает обмен веществ и способствует расщеплению жировых отложений. Грейпфрут также эффективно борется с бессонницей, поэтому есть его перед сном, бесспорно, даже крисно!

5. Мясо птицы

Лучше всего здесь подойдет филе индейки и курицы, как наиболее диетическое, особенно отварное. Оно практически не содержит углеводов, поэтому ваша фигура на 100% не пострадает, зато здесь также очень много белка, витаминов (А, Е, группы В) и минералов, которые помогут насытить организм, не перегружая его. Употреблять птицу на ночь лучше в количестве 100-150 и с овощами.

Читайте также: Готовим быстро и просто — 5 вкусных блюд на кефире

6. Авокадо

Вопреки различным мнениям, авокадо на ночь можно, и даже нужно есть! В правильном количестве, конечно же, но авокадо содержит моно- и полиненасыщенные жирные кислоты, которые не откладываются на проблемных зонах (да и в принципе ни на каких!), быстро усваиваются, более того — способствуют расщеплению уже имеющихся жиров. Авокадо не содержит холестерина и сахара, зато может похвастаться богатством витаминов, минералов и микроэлементов, благодаря которым поддерживает в тонусе весь организм, улучшает деятельность сердечно-сосудистой и нервной систем, состояние волос, кожи, и еще много много! Магний, содержащийся в авокадо — замечательный помощник при бессоннице. Все это — убедительные аргументы того, что половинка среднего авокадо на ночь вам совершенно разрешена.

7. Орехи

Орехи содержат многочисленные витамины и минералы, а самое главное — магний, витамины группы В и Омега 3, потому что именно они — лучшие борцы за качественный и спокойный сон. Много их есть нельзя, ведь тут уже нужно помнить о калораже, однако 30 г орешков съесть будет очень даже полезно.

8. Рыба

Морская рыба является мощным поставщиком качественного белка для ваших красоты и здоровья. Нежирные сорта рыбы (преимущественно белые) легко усваиваются, снижают уровень плохого холестерина и обогащают организм йодом и фосфором. Лучшим вариантом для позднего ужина будет 100-150 грамм хека, трески, камбалы, минтая или судака. В небольшом количестве можно себе также позволить тунец и креветки, и в идеале — с зелеными листовыми овощами (шпинат, брокколи, салат латук, ромэн и т.д.).

9. Тушеные овощи

Овощи всегда были, есть и будут идеальным перекусом и полноценным приемом пищи. Однако, если днем ​​лучше есть больше свежих овощей, то вечером и перед сном — в тушеном или вареном. Это аргументировано тем, что именно в приготовленном виде овощная клетчатка лучше и быстрее усваивается организмом, а также прекрасно прочищает кишечник.

Читайте также: Осенний десерт — 7 идей для фруктовых и овощных смузи


10. Ягоды

Большинство ягод, как и фруктов, включают в себя фруктозу и глюкозу. Именно поэтому, перед сном стоит есть только кисло-сладкие ягоды, больше всего для этого подойдут: вишня, черника и малина. Можно добавить к ним и несколько ложек нежирного кефира или натурального йогурта. Ягоды могут быть как свежими, так и замороженными, ведь их полезные свойства не подавляются заморозкой, поэтому организм обязательно получит свою дозу витаминов и антиоксидантов. Вишня, к тому же, является одним из природных источников мелатонина — гормона, который применяют для лечения бессонницы!


Итак, если есть перед сном ну очень хочется — не отказывайте себе в этом! Главное — это помнить о времени, количестве, как можно меньше продукты солить, и уж если готовить — то готовить без использования масла. Так и организм не пострадает, и сон станет крепче! К тому же, сидя на диете, вы не затем сорветесь на очередную шоколадку, и будете собой гордиться!

Информация и рецепты, изложенные в этом Блоге, могут не соответствовать ожиданиям пользователя, представлены к использованию без учета индивидуальных особенностей здоровья пользователя и применяются им по своему усмотрению и под личную ответственность.
Информация, документы и сопутствующие графические материалы и рецепты, взятые из других источников и опубликованные на этом сайте https://milkalliance.com.ua/, могут содержать технические погрешности и опечатки.

Что можно есть на ночь при похудении: список продуктов

Есть на ночь вредно  – это знаем мы все, в том числе и те, кто не увлекается похудением. На самом деле понятие вредности в этом случае, как и во многих других, является относительным. Далеко не все могут отказаться от поздних ужинов, особенно в том случае, если день был очень активным, и если во второй половине дня имела место быть активная тренировка. Что ж, тогда не стоит морить себя голодом, но вот к выбору продуктов, которые можно кушать вечером, нужно подходить ответственно, поскольку все съеденное в это время организм очень любит откладывать в жир. Тем не менее, можно устроить себе такой поздний ужин, который позволит избавиться от чувства голода, и при этом не навредит фигуре и полноценному сну. Для этого нужно знать, что можно есть на ночь при похудении.

Что можно есть на ночь при похудении: примеры полезных продуктов

Сначала о самом простом. Наш организм часто склонен путать голод и жажду. Если вы ощутили, что хотите есть тогда, когда лучше бы этого не делать, то попробуйте обмануть желудок, выпив стакан воды. Этот вариант, который можно выпить на ночь чтобы похудеть, не содержит калорий и совершенно безопасен для фигуры. Если же водичка не помогла, и кушать все равно хочется, то обратите внимание на следующие продукты.

Белковые продукты

Белки – лучший вариант того, что есть на ночь чтобы похудеть. Эти продукты хорошо насыщают, надолго позволяют забыть о голоде, кроме того, все они откладываются в мышечную массу, а не в жир, и заставляют организм сжигать больше калорий, что способствует похудению. Выбирайте белковые продукты с низким процентов жирности. Например, можно не боясь съесть кусочек отварной куриной грудки, приготовленную на пару рыбу, отварное яйцо или белковый омлет. Вообще считается, что в вечернее время стоит налегать именно на белковые продукты.

Творог

Продолжая тему о белках, мы не можем не сказать о нежирном твороге, который тоже можно употреблять вечером. Смело включайте его в  список продуктов что можно есть на ночь при похудении. Содержащийся в нем белок усваивается организмом легко и быстро – в течение 1,5 часов. Творог полезен и для спортсменов, и для тех, кто просто хочет похудеть. Лучше выбирать продукт с низким процентом жирности. Не добавляйте в него сахар – лучше использовать корицу или небольшое количество ягод, чтобы блюдо стало вкуснее.

Кефир

Кефир на ночь для похудения – самый популярный вариант среди худеющих. Этот продукт ни в коем случае не спровоцирует набор лишнего веса, а, кроме того, поможет улучшить сон и нормализовать работу кишечника. Кисломолочный напиток хорошо утоляет аппетит и может насытить не хуже полноценного ужина. Лучше пить на ночь чтобы похудеть кефир

низкой жирности без сахара и всевозможных искусственных добавок.

Для позднего ужина можно приготовить низкокалорийный кефирный супчик. Возьмите литр кефира, измельчите 1-2 огурца, пару зубчиков чеснока и пучок укропа, залейте все это кисломолочным напитком. Получите вкусный и безопасный ужин. Можно также заменить кефир простоквашей либо нежирным йогуртом.

Молоко

Любители молока могут побаловать себя стаканом этого напитка перед сном. Молоко на ночь для похудения полезно и тем, что помогает бороться с бессонницей. Если у вас есть проблемы со сном, то пейте теплый напиток, в который можно добавить чайную ложечку меда.

Фрукты

С фруктами все не так просто. Несмотря на то, что они содержат полезную клетчатку и много витаминов, некоторые из них вмещают большое количество сахара, что может серьезно затормозить процесс похудения. Важно правильно выбирать фрукты. В качестве вечернего перекуса подойдут несладкие и низкокалорийные плоды.

Яблоки на ночь при похудении – идеальный вариант притупить голод. Лучше выбирайте плоды зеленого цвета, в которых мало сахара. Чтобы организму было проще усвоить яблочко, очистите его от кожуры. Однако учтите, что в некоторых людей яблоки склонны разжигать аппетит. Чтобы избежать этого, можно их запекать и кушать с корицей. Последняя, кстати, обладает сильными жиросжигающими свойствами.

Неплохой вариант – это цитрусовые. Апельсин на ночь для похудения, например, обладает невысокой калорийностью, включает в себя много клетчатки и витамина С, поэтому подходит для позднего угощения. Еще один хороший вариант – грейпфрут для похудения на ночь, который обладает ничтожно малой калорийностью, и при  этом содержит ферменты, которые активизируют процесс жиросжигания. Также из фруктов можно кушать киви, груши, ананас, арбуз, различные ягоды и другие низкокалорийные продукты.

А вот с бананами лучше подождать до утра. Они обладают достаточно высокой калорийностью, кроме того, химический состав их способствует тому, что организм заряжается бодростью и энергией, что вечером нам явно не нужно. То же самое касается винограда и других очень сладких фруктов.

Овощи

Большинство овощей – это продукты, которые смело можно съесть на ночь при похудении. Почти все из них безопасны для фигуры, кроме, разве что, картофеля и других крахмалистых. Особое внимание можно обратить на так называемые продукты с отрицательной калорийностью, на усвоение которых организм тратит меньше энергии, чем в итоге получает. Можно кушать огурцы, помидоры, зелень, редис, морковь, капусту и так далее. Также можно употреблять овощные самодельные соки.

Продукты можно кушать в чистом воде или готовить из них простые блюда, например, различные салаты. Также можно добавлять различные специи – корицу, тмин, имбирь, карри, куркуму. Они помогают  улучшить обмен веществ и ускорить процессы жиросжигания даже в вечернее время.

Что нельзя есть на ночь при похудении?

Мы разобрались, что можно съесть на ночь чтобы похудеть. В основном это белки и растительная пища. Кроме того, существует обширный список продуктов, от которых в вечернее время стоит воздержаться.  Большинство из них, попадая в организм перед сном, остаются там до утра, отравляя организм. В этом случае человек, просыпаясь утром, ощущает слабость, вялость и усталость, поскольку полноценно не отдыхает. Это же приводит к набору лишних килограммов.  Итак, на ночь категорически не рекомендуется употреблять следующие группы продуктов:

  • Любой фаст-фуд и снеки: чипсы, крекеры, бургеры, поп-корн – в этих продуктах очень много калорий, жиров и простых углеводов, при этом, они нормально не насыщают, поэтому в вечернее время лучше их не кушать. Да и в принципе тем, кто следит за фигурой, лучше вычеркнуть их со своего рациона.
  • Жирное мясо. Оно переваривается очень долго, поэтому не даст вам нормально спать и может привести к набору лишних килограммов. Не стоит употреблять на ночь жирные виды мяса.
  • Мучные изделия, выпечка, макароны. Эти продукты хорошо заряжают энергией, поэтому подходят для употребления в первую половину дня. Вечером же их рекомендуется избегать. Они могут перевариваться быстро, но наверняка отложатся в качестве нежелательного жира.
  • Шоколад и прочие сладости. Кушать их вечером категорически нельзя – простые углеводы перед сном являются прямым путем к набору массы.
  • Сухофрукты. Хотя сами по себе они полезны, в них много фруктозы, поэтому вечером кушать их не стоит. Если вы любите сухофрукты, то оставьте их для завтрака или дневного перекуса.
  • Авокадо. Полезный продукт, но калорийный и включающий в себя достаточно большое количество жиров, поэтому, опять же, кушать его лучше днем.
  • Сладкие йогурты. Хотя кисломолочные продукты полезны, магазинные йогурты содержат огромное количество сахара и всевозможных консервантов. Лучше взять тот же кефир и добавить в него немного ягод и меда. Лучше отказаться от газированных вол. Алкоголь на ночь – тоже не лучшая идея. Он может спровоцировать проблемы со сном, да еще и неприятную головную боль с утра.

Как видите, существует немало вкусных и полезных продуктов, которые можно есть поздним вечером, даже если вы худеете.  Не стоит морить себя голодом, поскольку это может привести к срывам. Лучше выбрать что-то из разрешенных продуктов или согревающих напитков, которые не только не приведут к набору лишнего веса, но и будут способствовать похудению.

10 продуктов, которые можно есть на ночь, на видео

Что можно есть перед сном

21 августа 2020 г. Просмотров: 10332

Не есть перед сном — это важное правило почти каждого диетического рациона. Такой запрет базируется на том, что вся пища, съеденная на ночь, превратится в жир. На самом деле в правиле есть неточности. Далее о том, стоит ли включить ужин в свой рацион, какие продукты для этого подойдут, а каких стоит избегать.

Можно ли есть перед сном?

Бытует мнение, что есть перед сном нельзя ни при каких обстоятельствах и все съеденное непременно отложится жировой прослойкой на боках. Но перекус перед сном необходим, если организм этого требует.

Американские ученые провели эксперимент с участием двух групп людей, результаты которого были весьма противоречивы бытующему мнению. Первая группа не ужинала после 18:00, вторая питалась дробно (ужин был лёгкий, низкокалорийный за 2 часа до сна).

Результаты показали, что люди без ужина утром очень голодны и склонны к перееданию (более того, уровень сахара в крови падает, и возникает тяга к сладкому, жирному). А группа с ужином имеет равные показатели сахара, отсутствие сильного голода. При этом участники чувствуют себя лучше как физически, так и морально. А это, конечно же, залог успешной диеты без срывов.

Но все ученые сходятся в одном, что если в течение дня не было возможности нормально питаться, вечером, естественно, возникнет чувство голода. Чтобы справиться с ним и не набрать лишних килограммов, необходимо придерживаться определенных правил и выбирать правильные продукты перед сном.

Особенности вечернего перекуса:

  1. Лучше избегать высокоуглеводной и жирной пищи. Углеводы и жиры долго перевариваются, и если лечь спать слишком рано после такой пищи, она непременно отложится в жир на боках.
  2. Большинство худеющих продолжает придерживаться правила — не есть после 18.00, но диетологами давно уже развеян миф о пользе такого запрета. Ужин можно устроить за 4 часа до сна, а перекус — за 1-2 часа.
  3. Даже если вы поужинали слишком поздно, лучше немного подождать и не ложиться. Во-первых, процесс пищеварения будет мешать нормальному сну, во-вторых, все процессы во время сна замедляются.
  4. Калорийность ужина должна быть ниже, чем всех остальных приемов пищи.
  5. От позднего перекуса лучше отказаться, но если такой возможности нет, его энергетическая ценность должна быть равна стакану кефира.
  6. После вечернего перекуса не стоит ложиться или сидеть, нужна минимальная физическая нагрузка — прогулка по квартире или улице пойдет на пользу.
  7. Ужин стоит выбирать белковый, нежирный.
  8. Правильный способ приготовления — немаловажная деталь. Лучше выбирать отварные или тушеные продукты перед сном.
  9. Порция не должна превышать 250-300 грамм.

Какие продукты разрешены перед сном?

По мнению диетологов, правильный ужин и легкий вечерний перекус не навредит, а даже поможет в похудении. Но стоит знать, какие продукты можно есть перед сном. Поэтому, если без перекуса никак не обойтись, нужно остановить выбор на разрешенных продуктах и соблюдать все правила правильного ужина.

Самые полезные продукты перед сном, употребляя которые можно не только не навредить похудению, но и ему поспособствовать:

  • Филе курицы или индюшки. Наиболее правильный вариант для ужина — отварное филе, но его также можно стушить с овощами. В курином и индюшачьем филе фактически нет углеводов. Поэтому оно является лучшим решением, которое не навредит фигуре. К нему можно добавить легкий овощной салат без заправки или приправленный лимоном.
  • Яйца. Отличным вариантом ужина станут омлет на пару или отварные яйца. Белок яйца состоит из чистого белка, который легко усваивается. Но стоит учитывать высокую калорийность желтка, также в нем высокое содержание жира и холестерина. Поэтому от него стоит или вообще отказаться, или ограничить потребление яиц до двух целых. В омлет можно добавить молоко и горсть творога.
  • Твердый сыр с низким содержанием жира. Несколько ломтиков вкусного сыра помогут справиться с вечерним голодом, а в тандеме с овощным салатом станут полноценным ужином. Продукт богат витаминами и минерами, а также положительно влияет на пищеварение.
  • Молоко. Стакан теплого молока не только поможет справиться с голодом, но и улучшить сон. В нем содержится Триптофан — аминокислота, которая обладает седативным эффектом. В молоко можно добавить чайную ложку меда или корицы, чем сделать напиток еще более вкусным и полезным.
  • Обезжиренные кисломолочные продукты. Они содержат легкий белок, который хорошо усваивается организмом. При этом не перегружают пищеварительную систему, что немаловажно для диетического питания. Их можно отнести к списку полезных продуктов перед сном, потому что полезные бактерии способствуют улучшению метаболизма.
  • Авокадо. Утверждение, что авокадо содержит много жиров и является калорийным продуктом, действительно можно подтвердить. Но вот то, что его нельзя на ночь — ошибка. Авокадо содержит полезные растительные, жирные кислоты, которые легко усваиваются и не вредят похудению. Поэтому его относится к продуктам, которые можно есть перед сном.
  • Грецкие орехи. Продукт очень калорийный, но также имеет большую насыщаемость. Это значит, что горсть орехов до 40г утолит голод, не навредив фигуре.
  • Фрукты. Вопреки мнению о запрете употребления фруктов на ночь, диетологи утверждают, что их можно есть на ужин, но стоит выбирать несладкие. Предпочтение желательно отдать зеленым яблокам. Они низкокалорийные, но отлично утоляют голод. Можно запечь с творогом и медом, так яблоко будет не кислым.
    Отлично для перекуса подойдут грейпфрут и другие цитрусовые. Они богаты витаминами, в их состав входит нарингин, который увеличивает скорость обмена веществ, а также помогает расщеплять жиры. Продукт низкокалорийный, содержит полезную клетчатку.
    Для вечернего перекуса подойдет груша. Фрукт поможет очистить организм от шлаков и токсинов.
  • Рыба и морепродукты. Для ужина подойдут нежирные сорта рыбы, лучше белой. Это источник белка, который так необходим при похудении. Полезно рыбу употреблять с овощами, поэтому филе на овощной подушке или тушеное с овощами станет незаменимым на диете. Такой ужин поможет в борьбе с холестерином и обогатит организм йодом.
    Источником йода также является морская капуста, она тоже относится к продуктам, которые можно есть перед сном. На ужин можно приготовить морепродукты с чесночным соусом или лимонной заправкой, но такой вариант достаточно дорогостоящий.
  • Овощи. Они некалорийны и богаты полезной клетчаткой. Однако на ужин стоит отдать предпочтение тушеным или вареным овощным блюдам. Причиной тому является то, что клетчатка из приготовленных овощей усваивается лучше и быстрее. Хорошим вариантом станет овощная запеканка. Также можно сделать овощной смузи, он окажет детокс эффект и может справиться с вечерним чувством голода.

Если соблюдать все правила и знать, какие продукты есть перед сном, можно не боятся набрать лишние килограммы, не отказывая организму в вечернем перекусе.

Что нельзя есть перед сном?

Очень важно учитывать не только разрешенные продукты, но и те, которые запрещены к употреблению на ночь, чтобы на боках не прибавилось жировых складок, а на весах — лишних килограммов.

Что нельзя перед сном:

  • Фастфуд. Такие продукты стоит исключить из любого рациона. Они очень калорийны, при этом насыщение не длится долго. Зато гарантировано будет нарушена работа ЖКТ, появятся лишние килограммы и проблемы со здоровьем.
  • Макароны и хлебобулочные изделия. Это продукты, которые нельзя есть перед сном, так как они долго перевариваются, а значит, организм будет превращать их в жир.
  • Сладости. К ним относятся конфеты, шоколад, торты, пирожные, мороженое (фруктовое тоже не стоит употреблять на ужин), батончики и искусственные подсластители. Они имеют самую низкую насыщаемость при огромной калорийности. Сладости — это продукты с высоким гликемическим индексом, а значит, организм не сможет быстро справиться с выбрасываемой глюкозой и отложит часть в жир. После их употребления аппетит возвращается быстро и еще более ярко выраженным. Помимо этого, неприятным бонусом к жировым бокам станет кариес.
  • Супы. На первый взгляд кажется, что легкий суп на ужин — лучший вариант. Он не нанесет вреда фигуре, но стимулирует повышение аппетита. Через короткий промежуток времени аппетит вернется еще сильнее, чем до поедания супа. К тому же малой порцией первого блюда тяжело насытиться, а чем больше порция, тем более растянутый желудок в итоге.
  • Крупы. Очень полезны и необходимы для организма, но не перед сном. Они имеют большую калорийность и показывают огромную гликемическую нагрузку. Каши необходимо употреблять до обеда (или на обед).
  • Крахмалистые овощи. Несмотря на то, что на ужин можно употреблять овощи, необходимо избегать крахмалистых. Крахмал замедляет метаболизм. Также в крахмалистых овощах преобладают быстрые углеводы, которые отлаживаются в жир.
  • Жирное мясо. К нему относятся свинина, баранина, утка и другие. Тяжело усвояемы. Организм может не справиться с такими продуктами, которые нельзя есть перед сном, и запасти часть в жировых боках.
  • Соленые блюда. Ужин не стоит солить во время приготовления. Излишек соли на ночь может спровоцировать задержку жидкости и отеки. В результате — лишние килограммы на весах и снижение мотивации к похудению.
  • Копчености. Содержат очень много соли, что впоследствии вызывает чувство жажды. А жажду часто путают с голодом, риск сорваться и переесть моментально возрастает.
  • Жареное. Калорийность продуктов во время жарки заметно увеличивается, а также теряются все полезные свойства, содержащиеся в них.
  • Острые блюда. Чем более ярко выраженный вкус блюда, тем больше аппетит. Поэтому лучше отказаться от специй во время приготовления ужина. Острые блюда хочется заесть и запить, что вовсе не хорошо для вечера.
  • Консервированные и маринованные овощи. Содержание сахара и уксуса в продуктах оказывает негативное влияние, провоцирует рост аппетита, кроме того, повышенное количество соли может спровоцировать возникновение повышенной жажды и отеков.
  • Сладкие фрукты. К таким можно отнести манго, бананы, хурму и виноград.
  • Соевый соус. Многие ошибочно считают, что соль можно заменить соевым соусом. В нем также много соли, которая окажет негативное влияние на худеющий организм.
  • Семечки. Имеют очень высокую калорийность. И на небольшой горсти тяжело остановиться. Провоцируют жажду и аппетит.
  • Алкогольные напитки. Диетологи разрешают во время диеты иногда побаловать себя бокалом сухого вина, но не стоит это делать перед сном. Алкоголь способен пробуждать аппетит, и соответственно риск срыва возрастает. Крепкие напитки имеют высокую калорийность. Помимо этого, прием спиртного вечером плохо сказывается на общем самочувствии. В результате: сухость во рту, темные круги под глазами и сниженная работоспособность на весь день.
  • Кофе. Еще один напиток, который нельзя пить перед сном. Аналогично алкоголю, повышает аппетит. Помимо этого, высокое содержание кофеина не даст уснуть вовремя, а это еще шанс перекусить лишний раз перед сном.
  • Газированные напитки. Вызывают метеоризм в желудке, что не способствует хорошему сну, а также содержат огромное количество сахаров.
Автор: Алла Федорченко
Практикующий эндокринолог-диетолог по вопросам здоровья и молодости, сахарного диабета, щитовидной железы, ожирения, похудения и стройности.

Можно ли есть перед сном? Какие продукты разрешены, а от каких необходимо отказаться?

Не есть перед сном — это важное правило почти каждого диетического рациона. Такой запрет базируется на том, что вся пища, съеденная на ночь, превратится в жир. На самом деле в правиле есть неточности. Далее о том, стоит ли включить ужин в свой рацион, какие продукты для этого подойдут, а каких стоит избегать.

Можно ли есть перед сном?

Бытует мнение, что есть перед сном нельзя ни при каких обстоятельствах и все съеденное непременно отложится жировой прослойкой на боках. Но перекус перед сном необходим, если организм этого требует.

Американские ученые провели эксперимент с участием двух групп людей, результаты которого были весьма противоречивы бытующему мнению. Первая группа не ужинала после 18:00, вторая питалась дробно (ужин был лёгкий, низкокалорийный за 2 часа до сна).

Результаты показали, что люди без ужина утром очень голодны и склонны к перееданию (более того, уровень сахара в крови падает, и возникает тяга к сладкому, жирному). А группа с ужином имеет равные показатели сахара, отсутствие сильного голода. При этом участники чувствуют себя лучше как физически, так и морально. А это, конечно же, залог успешной диеты без срывов.

Но все ученые сходятся в одном, что если в течение дня не было возможности нормально питаться, вечером, естественно, возникнет чувство голода. Чтобы справиться с ним и не набрать лишних килограммов, необходимо придерживаться определенных правил и выбирать правильные продукты перед сном.

Особенности вечернего перекуса:

  1. Лучше избегать высокоуглеводной и жирной пищи. Углеводы и жиры долго перевариваются, и если лечь спать слишком рано после такой пищи, она непременно отложится в жир на боках.
  2. Большинство худеющих продолжает придерживаться правила — не есть после 18.00, но диетологами давно уже развеян миф о пользе такого запрета. Ужин можно устроить за 4 часа до сна, а перекус — за 1-2 часа.
  3. Даже если вы поужинали слишком поздно, лучше немного подождать и не ложиться. Во-первых, процесс пищеварения будет мешать нормальному сну, во-вторых, все процессы во время сна замедляются.
  4. Калорийность ужина должна быть ниже, чем всех остальных приемов пищи.
  5. От позднего перекуса лучше отказаться, но если такой возможности нет, его энергетическая ценность должна быть равна стакану кефира.
  6. После вечернего перекуса не стоит ложиться или сидеть, нужна минимальная физическая нагрузка — прогулка по квартире или улице пойдет на пользу.
  7. Ужин стоит выбирать белковый, нежирный.
  8. Правильный способ приготовления — немаловажная деталь. Лучше выбирать отварные или тушеные продукты перед сном.
  9. Порция не должна превышать 250-300 грамм.

Какие продукты разрешены перед сном?

По мнению диетологов, правильный ужин и легкий вечерний перекус не навредит, а даже поможет в похудении. Но стоит знать, какие продукты можно есть перед сном. Поэтому, если без перекуса никак не обойтись, нужно остановить выбор на разрешенных продуктах и соблюдать все правила правильного ужина.

Самые полезные продукты перед сном, употребляя которые можно не только не навредить похудению, но и ему поспособствовать:

  • Филе курицы или индюшки. Наиболее правильный вариант для ужина — отварное филе, но его также можно стушить с овощами. В курином и индюшачьем филе фактически нет углеводов. Поэтому оно является лучшим решением, которое не навредит фигуре. К нему можно добавить легкий овощной салат без заправки или приправленный лимоном.
  • Яйца. Отличным вариантом ужина станут омлет на пару или отварные яйца. Белок яйца состоит из чистого белка, который легко усваивается. Но стоит учитывать высокую калорийность желтка, также в нем высокое содержание жира и холестерина. Поэтому от него стоит или вообще отказаться, или ограничить потребление яиц до двух целых. В омлет можно добавить молоко и горсть творога.
  • Твердый сыр с низким содержанием жира. Несколько ломтиков вкусного сыра помогут справиться с вечерним голодом, а в тандеме с овощным салатом станут полноценным ужином. Продукт богат витаминами и минерами, а также положительно влияет на пищеварение.
  • Молоко. Стакан теплого молока не только поможет справиться с голодом, но и улучшить сон. В нем содержится Триптофан — аминокислота, которая обладает седативным эффектом. В молоко можно добавить чайную ложку меда или корицы, чем сделать напиток еще более вкусным и полезным.
  • Обезжиренные кисломолочные продукты. Они содержат легкий белок, который хорошо усваивается организмом. При этом не перегружают пищеварительную систему, что немаловажно для диетического питания. Их можно отнести к списку полезных продуктов перед сном, потому что полезные бактерии способствуют улучшению метаболизма.
  • Авокадо. Утверждение, что авокадо содержит много жиров и является калорийным продуктом, действительно можно подтвердить. Но вот то, что его нельзя на ночь — ошибка. Авокадо содержит полезные растительные, жирные кислоты, которые легко усваиваются и не вредят похудению. Поэтому его относится к продуктам, которые можно есть перед сном.
  • Грецкие орехи. Продукт очень калорийный, но также имеет большую насыщаемость. Это значит, что горсть орехов до 40г утолит голод, не навредив фигуре.
  • Фрукты. Вопреки мнению о запрете употребления фруктов на ночь, диетологи утверждают, что их можно есть на ужин, но стоит выбирать несладкие. Предпочтение желательно отдать зеленым яблокам. Они низкокалорийные, но отлично утоляют голод. Можно запечь с творогом и медом, так яблоко будет не кислым.
    Отлично для перекуса подойдут грейпфрут и другие цитрусовые. Они богаты витаминами, в их состав входит нарингин, который увеличивает скорость обмена веществ, а также помогает расщеплять жиры. Продукт низкокалорийный, содержит полезную клетчатку.
    Для вечернего перекуса подойдет груша. Фрукт поможет очистить организм от шлаков и токсинов.
  • Рыба и морепродукты. Для ужина подойдут нежирные сорта рыбы, лучше белой. Это источник белка, который так необходим при похудении. Полезно рыбу употреблять с овощами, поэтому филе на овощной подушке или тушеное с овощами станет незаменимым на диете. Такой ужин поможет в борьбе с холестерином и обогатит организм йодом.
    Источником йода также является морская капуста, она тоже относится к продуктам, которые можно есть перед сном. На ужин можно приготовить морепродукты с чесночным соусом или лимонной заправкой, но такой вариант достаточно дорогостоящий.
  • Овощи. Они некалорийны и богаты полезной клетчаткой. Однако на ужин стоит отдать предпочтение тушеным или вареным овощным блюдам. Причиной тому является то, что клетчатка из приготовленных овощей усваивается лучше и быстрее. Хорошим вариантом станет овощная запеканка. Также можно сделать овощной смузи, он окажет детокс эффект и может справиться с вечерним чувством голода.

Если соблюдать все правила и знать, какие продукты есть перед сном, можно не боятся набрать лишние килограммы, не отказывая организму в вечернем перекусе.

Что нельзя есть перед сном?

Очень важно учитывать не только разрешенные продукты, но и те, которые запрещены к употреблению на ночь, чтобы на боках не прибавилось жировых складок, а на весах — лишних килограммов.

Что нельзя перед сном:

  • Фастфуд. Такие продукты стоит исключить из любого рациона. Они очень калорийны, при этом насыщение не длится долго. Зато гарантировано будет нарушена работа ЖКТ, появятся лишние килограммы и проблемы со здоровьем.
  • Макароны и хлебобулочные изделия. Это продукты, которые нельзя есть перед сном, так как они долго перевариваются, а значит, организм будет превращать их в жир.
  • Сладости. К ним относятся конфеты, шоколад, торты, пирожные, мороженое (фруктовое тоже не стоит употреблять на ужин), батончики и искусственные подсластители. Они имеют самую низкую насыщаемость при огромной калорийности. Сладости — это продукты с высоким гликемическим индексом, а значит, организм не сможет быстро справиться с выбрасываемой глюкозой и отложит часть в жир. После их употребления аппетит возвращается быстро и еще более ярко выраженным. Помимо этого, неприятным бонусом к жировым бокам станет кариес.
  • Супы. На первый взгляд кажется, что легкий суп на ужин — лучший вариант. Он не нанесет вреда фигуре, но стимулирует повышение аппетита. Через короткий промежуток времени аппетит вернется еще сильнее, чем до поедания супа. К тому же малой порцией первого блюда тяжело насытиться, а чем больше порция, тем более растянутый желудок в итоге.
  • Крупы. Очень полезны и необходимы для организма, но не перед сном. Они имеют большую калорийность и показывают огромную гликемическую нагрузку. Каши необходимо употреблять до обеда (или на обед).
  • Крахмалистые овощи. Несмотря на то, что на ужин можно употреблять овощи, необходимо избегать крахмалистых. Крахмал замедляет метаболизм. Также в крахмалистых овощах преобладают быстрые углеводы, которые отлаживаются в жир.
  • Жирное мясо. К нему относятся свинина, баранина, утка и другие. Тяжело усвояемы. Организм может не справиться с такими продуктами, которые нельзя есть перед сном, и запасти часть в жировых боках.
  • Соленые блюда. Ужин не стоит солить во время приготовления. Излишек соли на ночь может спровоцировать задержку жидкости и отеки. В результате — лишние килограммы на весах и снижение мотивации к похудению.
  • Копчености. Содержат очень много соли, что впоследствии вызывает чувство жажды. А жажду часто путают с голодом, риск сорваться и переесть моментально возрастает.
  • Жареное. Калорийность продуктов во время жарки заметно увеличивается, а также теряются все полезные свойства, содержащиеся в них.
  • Острые блюда. Чем более ярко выраженный вкус блюда, тем больше аппетит. Поэтому лучше отказаться от специй во время приготовления ужина. Острые блюда хочется заесть и запить, что вовсе не хорошо для вечера.
  • Консервированные и маринованные овощи. Содержание сахара и уксуса в продуктах оказывает негативное влияние, провоцирует рост аппетита, кроме того, повышенное количество соли может спровоцировать возникновение повышенной жажды и отеков.
  • Сладкие фрукты. К таким можно отнести манго, бананы, хурму и виноград.
  • Соевый соус. Многие ошибочно считают, что соль можно заменить соевым соусом. В нем также много соли, которая окажет негативное влияние на худеющий организм.
  • Семечки. Имеют очень высокую калорийность. И на небольшой горсти тяжело остановиться. Провоцируют жажду и аппетит.
  • Алкогольные напитки. Диетологи разрешают во время диеты иногда побаловать себя бокалом сухого вина, но не стоит это делать перед сном. Алкоголь способен пробуждать аппетит, и соответственно риск срыва возрастает. Крепкие напитки имеют высокую калорийность. Помимо этого, прием спиртного вечером плохо сказывается на общем самочувствии. В результате: сухость во рту, темные круги под глазами и сниженная работоспособность на весь день.
  • Кофе. Еще один напиток, который нельзя пить перед сном. Аналогично алкоголю, повышает аппетит. Помимо этого, высокое содержание кофеина не даст уснуть вовремя, а это еще шанс перекусить лишний раз перед сном.
  • Газированные напитки. Вызывают метеоризм в желудке, что не способствует хорошему сну, а также содержат огромное количество сахаров.

Что можно есть перед сном — смотрите на видео:

Учеными доказана польза от ужина в рационе. Главное — соблюдать простые правила и знать, какие продукты нельзя есть перед сном. Тогда удастся получить отличные результаты похудения.

Читать источник: tutknow.ru

7 напитков и 9 продуктов без вреда для фигуры

В этой статье:

  • Стоит ли вообще есть на ночь
  • Напитки, которые можно пить на ночь
  • 9 продуктов, которые можно съесть на ночь без вреда для фигуры и лечь в постель
  • Рецепты ПП-блюд, которые можно съесть на ночь
  • Что точно не стоит есть на ночь

Походы к холодильнику в полной темноте для многих не редкость. Причем без зазрения совести и без вреда для фигуры. А это уже гораздо более сложная задача, ведь вечером пищеварительная система готовится к отдыху, и лишний кусочек заставляет желудок усиленно трудиться всю ночь, беспокоя своего владельца бурлением.

Что можно съесть на ночь без особых последствий? На самом деле, безопасных для ночного перекуса продуктов не так уж много. И потому после ужина лучше перебороть себя, выпить стакан воды комнатной температуры и отправиться спать. Но если для вас это непосильная задача, самое время узнать кое-какие секреты.

Стоит ли вообще есть на ночь


Если вы когда-нибудь интересовались темой здорового питания, то, скорее всего, слышали расхожее мнение о том, что после шести часов вечера, а, тем более, ночью, есть нельзя. Современные диетологи утверждают, что это заблуждение. Ужин вполне может быть поздним.

Единственное, необходимо разобраться, что можно съесть на ночь без вреда для фигуры и хорошего пищеварения.

Когда мы ложимся спать, обменные процессы в организме не останавливаются. Чтобы обеспечить функционирование всех его систем, необходима энергия, которую можно получить из еды. Тем не менее, не стоит переедать на ночь.

Пищеварение ночью также продолжается, поэтому поужинать перед сном нужно, это совершенно не опасно, и, даже, полезно. Гораздо хуже лечь спать с пустым желудком, ведь это может повлечь за собой ряд проблем, таких как бессонница, головные боли, расстройства, и, что гораздо опаснее, заболевания пищеварительной системы и нарушения обмена веществ.

В то же время необходимо учесть, что в первой половине дня увеличен расход энергии на переваривание пищи, вечером же на эти процессы тратится меньше калорий. Это значит, что если переесть за ужином, особенно тяжелой еды, то она не успеет перевариться и будет гнить в кишечнике, что может явиться причиной некоторых заболеваний ЖКТ, и, к тому же, вам будет обеспечено плохое самочувствие и прибавка в весе.

Есть еще один нюанс − на переваривание белковой пищи требуется больше энергии, чем на переваривание углеводов, и, особенно, жиров. Поэтому, чтобы не тормозить процессы похудения, которые происходят именно во сне за счет выработки гормона соматропина, сжигающего жировые клетки, стоит выбирать на ужин пищу, богатую белком. Быстрые углеводы же блокируют работу соматропина из-за своей высокой энергоемкости. Но даже белковую еду нужно употреблять в умеренных количествах, не превышая вашей нормы. 

Напитки, которые можно пить на ночь


  • Кисломолочные напитки без добавления сахара

В качестве легкого ужина на ночь можно съесть ряженку, кефир, бифидок, натуральные йогурты , которые способствуют нормализации пищеварения, к тому же они сытные и являются источником кальция.

Если очень сильно хочется кушать, на ночь можно употребить горячий напиток. Он согревает и успокаивает желудок. Если голод вы перепутали с чувством жажды, то кушать вам больше не захочется. К тому же, имбирь снижает воздействие на организм кофеина, содержащегося в чае. Не добавляйте в напиток сахар.

  • Молоко с медом

Этот напиток с давних времен давали детям перед сном. Молоко успокаивает и способствует быстрому засыпанию. К тому же оно позволяет бороться со стрессом, влияя на выработку гормона серотонина. Мед увеличивает энергетическую ценность напитка за счет большого количества быстрых углеводов, но, в то же время, он также способствует выработке гормона радости.

  • Натуральный сок вишни

Стакан такого сока позволит очень быстро уснуть, так как вишня способствует выработке гормона сна − мелатонина.

  • Бульон из курицы или овощей

При похудении на ночь можно съесть бульон. Он не позволит вам переесть, но отлично перебьет чувство голода. Можно приготовить жидкий бульон-крем, взбив блендером в бульоне небольшое количество овощей или куриного мяса. Не употребляйте на ночь бобовые, они долго перевариваются, из-за чего вы не сможете крепко спать.

  • Смузи из свежих овощей и фруктов

Для приготовления этого напитка используют несколько видов низкокалорийных овощей и фруктов, которые режут на кусочки и отправляют в блендер. Можно добавить в качестве основы молоко, но на ночь лучше использовать обычную воду. Напиток питателен и богат витаминами.

  • Травяной отвар

Такие травы как мята, пустырник, валериана, ромашка, чабрец успокаивают и способствуют крепкому спокойному сну. Можно добавить в отвар чайную ложку меда. Этот напиток отлично утолит чувство голода перед сном.

9 продуктов, которые можно съесть на ночь без вреда для фигуры и лечь в постель

Как мы уже говорили выше, вечером не просто можно, но даже нужно принимать пищу. Но что можно есть на ночь, чтобы утолить голод и не тормозить процесс похудения?

  1. Овощи в любом виде


    Если очень хочется кушать, на ночь можно съесть овощи в любом виде. Это основа рациона питания любого человека, придерживающего здорового питания. Можно есть сырые овощи, овощное рагу, овощи на гриле, заготовки из овощей, салаты и еще массу вариантов приготовления этих полезных и вкусных продуктов. От такого ужина невозможно потолстеть, поэтому это то, что можно есть на ночь, чтобы не поправиться. 

    Овощи обладают низкой калорийностью, в них много витаминов и минералов, они нормализуют работу желудочно-кишечного тракта, способствуют становлению здоровой миклофлоры, влияют на процессы жиросжигания, ускоряют обмен веществ, выводят шлаки и токсины. Перечислять преимущества употребления овощей можно бесконечно. 

    Если вы хотите сохранить стройность, отдайте предпочтение зелени. Ее допустимо кушать в неограниченных количествах и совершенно в любых сочетаниях. Можно приготовить салат из некрахмалистых овощей (огурцы, помидоры, брокколи, перец, капуста) и любой зелени. Даже большая порция такого блюда вряд ли будет содержать более 100 ккал. 

    Тыкву, картофель, морковь и свеклу тоже допустимо употреблять на ночь, но учитывайте, что они калорийнее некрахмалистых овощей. Блюда не должны быть жаренными на масле. Для вечернего перекуса не подойдут бобовые и зерновые, которые довольно тяжело перевариваются. Хотя, если не злоупотреблять, можно позволить себе даже их.

  2. Курица, индейка


    Нежирное филе курицы или индейки в отварном или тушеном виде − еще один вариант белкового ужина. На 100 грамм мяса птицы приходится около 90-110 ккал, к тому же, оно довольно питательно. На гарнир к мясу идеально подать овощи на пару или в сыром виде.

    Помимо мяса птицы можно употреблять и другие виды нежирного мяса, например, крольчатину. В нем всего 150-160 ккал на 100 грамм.

  3. Нежирная рыба


    Белая рыба отлично подойдет в качестве ужина. В ней содержится мало жира, зато много белка и фосфора. Рыба легко усваивается организмом, способствует снижению холестерина. Для позднего ужина подойдут щука, сайра, треска, хек, судак, форель, минтай. Конечно, на ночь не стоит употреблять жаренную в масле рыбу, а вот запеченную или приготовленную на гриле с овощами вполне можно. Калорийность такого блюда на 100 грамм составит примерно 100-150 ккал. 

  4. Творог


    Нежирный творог − еще один вариант низкокалорийного белкового ужина. Не стоит выбирать самые жирные или обезжиренные сорта творога. И, конечно, в твороге не должно быть добавок в виде цукатов или изюма.

    Как и все другие кисломолочные продукты, творог отлично влияет на микрофлору кишечника.

  5. Яйца


    Вареные яйца или омлет с овощами не нанесут вреда вашей фигуре и здоровью, если съесть их на ужин. В них соблюден баланс белка, углеводов и полезных жиров, которые легко перевариваются и очень полезны для организма.

    На 100 грамм яичной массы (два средних яйца) приходится около 140-160 ккал. Если вы соблюдаете низкокалорийную диету, можно употреблять только белки.

  6. Морепродукты


    В морепродуктах много белка и мало калорий, поэтому их можно есть на ночь при похудении.

    В качестве гарнира для позднего ужина к морепродуктам не стоит выбирать макароны или поджаренный багет. Ограничьтесь салатом из свежих или отварных некрахмалистых овощей и зелени.

  7. Ягоды и цитрусовые


    Фрукты и ягоды довольно калорийные, поэтому их можно употреблять в качестве полноценного приема пищи. Однако некоторые из них в ограниченных количествах подойдут и для позднего перекуса.

    Перед сном можно без угрызений совести съесть ягоды. Их калорийность составляет 70-100 ккал на один стакан. Ягоды богаты витаминами, пектином, стимулирующим перистальтику кишечника, а также антиоксидантами.

    В чернике содержится большое количестве пантотеновой кислоты, которая улучшает зрение и деятельность головного мозга. В смородине, клубнике и цитрусовых много витамина С. Кокос богат полезными жирными кислотами, железом, кальцием, витамином Е и никотиновой кислотой, которая предупреждает развитие болезни Паркинсона и Альцгеймера.

    Цитрусовые также богаты клетчаткой, а еще для вечернего перекуса подойдут яблоки и груши.

    Стоит отказаться перед сном от сладких и высококалорийных фруктов, таких как бананы, виноград, манго.

  8. Семечки и орехи


    Грецкие орехи, кешью, фундук и миндаль содержат очень много жиров и очень калорийны. В то же время, всего несколько штук орешков утоляют голод. Орехи полезны для мозговой деятельности.  Семена тыквы содержат магний, который важен для здорового сна.

  9. Грибы


    Речь не идет о жареной картошке с грибами или шампиньонах под сырной корочкой. В качестве легкого ужина можно позволить себе грибы на гриле или диетический суп-пюре. В таком случае на одну порцию блюда придется не более 100-150 ккал, а вы обеспечите организм полезным белком. К тому же блюда из грибов очень вкусные.

Рецепты ПП-блюд, которые можно съесть на ночь

Если вы не можете уснуть без перекуса, заранее приготовьте себе что-то низкокалорийное, чтобы во время вечернего похода к холодильнику не отвлекаться на колбасу и пирожные.

  • Яблоки, запеченные в духовке

Яблоко необходимо разрезать пополам, вырезать серединку, запечь в микроволновке или духовке и посыпать корицей. Если очень хочется сладкого, можно добавить немного меда.

Это низкокалорийное блюдо, богатое клетчаткой. К тому же мед содержит большое количество витаминов и полезных веществ, способствующих нормализации сна.

Ее можно есть не только на завтрак, но и в качестве позднего ужина. Выбирайте овсянку долгой варки, готовьте ее на обезжиренном молоке, а в качестве подстластителя выбирайте не сахар, а фрукты или сухофрукты. Каша быстро избавит вас от чувства голода и надолго насытит.

  • Куриная грудка

Приготовьте ее на пару или в духовке и добавьте брокколи. Такое блюда переварится уже через полтора часа.

  • Белковый омлет

Отделите желтки от белков, желтки не употребляйте, они долго перевариваются. Приготовьте омлет в микроволновке в специальной посуде, без использования масла. Посыпьте белок зеленью, и вкусное сытное блюдо готово.

  • Хлебцы из цельнозерновой муки

Приготовьте бутерброды с сыром нежирных сортов и листом салата. Сыр богат витаминами, кальцием и полезными жирными кислотами. Это легкий и сытный перекус.

  • Натуральный фруктовый лед

Приготовьте свежевыжатый сок и заморозьте его в формочках для льда. Десерт получится низкокалорийным и очень вкусным. Можно использовать не только сок, но и кусочки фруктов. Заполните формочки для льда соком только на 2/3 и положите в каждый отсек по фруктовому кусочку.

  • Нежирный творог со сметаной или сухофруктами

Творог богат кальцием, к тому же он очень питателен. Такой ужин не добавит вам проблем с пищеварением и отлично подойдет перед сном. В небольшом количестве это блюда будет полезно на ночь.

Что точно не стоит есть на ночь


Существует и ряд продуктов, которые нельзя употреблять перед сном, так как они долго перевариваются и замедляют обмен веществ:

  • Шоколад, кофе, энергетики. Они содержат кофеин, который возбуждает нервную систему и не дает уснуть.
  • Небольшое количество алкоголя может помочь уснуть, но, если перебрать, ваш нормальный сон будет нарушен.
  • Бобовые очень долго перевариваются.
  • Говядина переваривается 4-5 часов, поэтому ее не стоит есть перед сном.
  • Свинина и баранина будет усваиваться организмом в течение 5-6 часов.
  • Любая жирная пища, приготовленная в большом количестве масла. Она долго переваривается, вызывает дискомфорт в кишечнике, который мешает здоровому сну.
  • Выпечка, сладости, конфеты и печенья. Это очень калорийные продукты, которые способствует отложению подкожного жира. К тому же, они насыщают ненадолго, и очень скоро человек снова захочет есть.

Эти продукты можно употреблять в первой половине дня и в ограниченных количествах.

Это далеко не все варианты полезного и легкого ужина. Можно составить свое меню продуктов, которые допустимо есть перед сном. Руководствуйтесь следующими правилами: не ешьте за пару часов до отхода ко сну, выбирайте легкие белковые продукты, не употребляйте более 200 грамм пищи калорийностью более 200 ккал. Если следовать этим простым советам, ночной перекус никак не отразится на вашей фигуре, а чувство голода не будет мучить вас и мешать уснуть.

Есть на ночь – полезно! 9 продуктов, которые можно есть перед сном

Есть на ночь вредно! После шести вечера заприте холодильник! Если вы все еще придерживаетесь таких правил вроде бы «здорового питания», должны вам сообщить, что они остались далеко в прошлом. Современная наука настаивает, что есть вечером не только можно, но и нужно!

Главное – разобраться, как работает наш организм ночью и какие именно продукты можно есть на ужин действительно без вреда для фигуры.

Стоит ли вообще есть на ночь?

Когда вы ложитесь спать, ваш организм не отключается полностью вместе с вами, а продолжает функционировать. И задача ужина – обеспечить все происходящие внутри вас процессы ресурсами. Внимание – ресурсами, но не их избытком!

Желудочно-кишечный тракт ночью тоже не «спит», поэтому в вечернем приеме пищи нет ничего опасного для организма. Даже наоборот – ложиться спать голодным очень вредно. Это с большой долей вероятности повлечет за собой различные проблемы – от бессонницы, головной боли на утро и плохого настроения до серьезных заболеваний ЖКТ и нарушения обмена веществ.

Важно лишь помнить, что в утренние часы расход энергии на пищеварение увеличен, а к вечеру заметно снижается. То есть если вы выберете на ужин излишне калорийную пищу, да еще в больших количествах, велика вероятность того, что она просто не успеет перевариться и начнет загнивать в кишечнике, обеспечивая ЖКТ различные заболевания, а вам плохое самочувствие и ожирение.

Также не забывайте, что расход энергии на переваривание белковой пищи более высок, чем для углеводной, и минимален при переваривании жиров. Так что если хотите худеть во сне (а это реально, ведь именно ночью гипофиз производит гормон соматотропин, чье действие направлено в том числе и на сжигание жировых клеток), выбирать для вечерней трапезы стоит пищу с низким содержанием жиров и углеводов, которые могут блокировать работу гормона за счет своей высокой энергоемкости, в идеале – белковую, к тому же в рациональной дозе.

Что можно есть на ночь?

Итак, мы выяснили, что ужинать нужно обязательно. Но что именно можно употреблять вечером, чтобы не только не доставить проблем своему организму, но даже похудеть? Разумеется, из вечернего меню следует исключить алкоголь или продукты с кофеином, которые только помешают заснуть, а также калорийную и тяжелую пищу вроде сладкой выпечки или жирного жареного мяса, которые создадут ненужную нагрузку на ЖКТ, а обратить внимание на «легкие» продукты, которые могут усвоиться относительно быстро, за час-полтора. В основном это, конечно, белковая пища и клетчатка.

Вашему вниманию – топ-9 продуктов, которые полезно есть перед сном!

Сырые, тушеные или отварные овощи

Лучшим ужином, пожалуй, стоит признать овощи как в сыром, так и в приготовленном виде – это и так важнейший ингредиент меню здорового человека, а уж для позднего приема пищи они вообще идеальны. Салат из листовой зелени, овощное рагу, овощи на гриле, отварные, тушеные и запеченные, и даже овощной суп и кабачковая икра – вариантов полезного вечернего перекуса, от которого не только не потолстеешь, но даже начнешь худеть – масса!

Овощи низкокалорийны, богаты полезнейшей клетчаткой и витаминами, нормализуют кишечную флору, благотворно воздействуют на работу желудочно-кишечного тракта, способствуют сжиганию жиров и укреплению иммунитета, выводят шлаки – пользу их трудно переоценить.

Конечно, если заботитесь о фигуре, лучше отдать предпочтение зелени в любых количествах и сочетаниях. листовым (салат, шпинат) и некрахмалистым (огурцы, помидоры, брокколи, болгарский перец, капуста, сельдерей) овощам. Здесь вы вряд ли съедите более 100 ккал на порцию.

С оглядкой на калорийность на ужин можно позволить себе также кабачки, тыкву, баклажаны, картофель, морковь и свеклу – разумеется, без масла и не в жареном виде. Самыми же «опасными» для вечернего перекуса будут являться бобовые и зерновые, которые тяжеловаты для позднего приема пищи, но и они не принесут особого вреда, если употреблять их не ежедневно и в разумных дозах.

Кисломолочные продукты без добавок

Несладкие кисломолочные продукты вроде кефира, греческого йогурта, ряженки или простокваши безо всяких добавок – также отличный выбор для вечернего приема пищи. В 100 г такого перекуса всего 50-70 ккал – разумеется, речь не идет о продуктах повышенной жирности.

Это прекрасный источник белка, который легко утоляет голод, не провоцируя появление тяжести в желудке, и полезнейшего кальция, необходимого для здоровья костей. А еще кисломолочные продукты благотворно действуют на микрофлору желудочно-кишечного тракта, способствуют ускоренной переработке остальной пищи, снижают кислотность и обладают успокаивающими свойствами, что как нельзя кстати перед сном.

Мясо птицы

Нежирное мясо птицы без кожицы в отварном, тушеном или запеченном виде – еще один вариант полезного белкового перекуса, позволяющего быстро насытиться в вечернее время. В 100 г куриной грудки или индейки всего 90-110 ккал. Идеальным дополнением к мясу птицы для ужина станет гарнир из все тех же свежих или тушеных овощей.

Мясо птицы на ужине вполне можно заменить нежирным отварным или тушеным мясом вроде крольчатины. Это 150-160 ккал на 100 г продукта. Опять же в комплекте с овощами.

Белая рыба

Нежирная белая рыба в количестве около 100 г также вполне годится для ужина. В ней совсем мало жира, а вот полезного белка вкупе с йодом и фосфором предостаточно. Рыба легко усваивается, а заодно способствует снижению вредного холестерина в крови. Подходящие сорта рыбы для позднего ужина – щука, сайра, треска, хек, судак, форель, минтай. Разумеется, рыбу не стоит жарить в масле, а следует отварить или запечь с овощами, можно на гриле – в этом случае калорийность 100 г не превысит 100-150 ккал.

Творог

Маложирный творог – еще один отличный белковый выбор для ужина. Важно только выбирать для вечернего перекуса не самые жирные, но и не полностью обезжиренные его сорта, и, само собой, безо всяких добавок вроде изюма.

К тому же, как мы помним, кисломолочные продукты прекрасно влияют на ЖКТ.

Яйца

Отварные яйца или омлет (можно с овощами) также не принесут вашему организму никакого вреда, будучи съеденными за 2-3 часа до сна. Это и легкоусвояемый белок, и витамины, и полезные жирные кислоты.

В 100 г яичной массы около 140-160 ккал (это два средних яйца), а если вы на диете, можете уменьшить и это число, приготовив омлет из одних яичных белков.

Морепродукты

Благодаря высокому содержанию в морепродуктах белков они являются ценным диетическим продуктом, так как содержат к тому же совсем мало калорий.

Разумеется, для вечернего перекуса не стоит их комбинировать с пастой или поджаренным багетом – идеальным вариантом будет салат из некрахмалистых (помидоры, брокколи, огурцы) и листовых овощей или те же тушеные овощи.

Ягоды и цитрусовые

Конечно, все знают, что в ягодах и фруктах достаточно калорий, чтобы можно было их без опаски употреблять в качестве полноценного ужина. Однако некоторые из них вполне подойдут для вечернего перекуса, если не злоупотреблять количеством.

Лучший выбор для вечера – свежие ягоды, которых в стакане обычно не более 70-100 ккал. А вместе с ними вы получите клетчатку и пектины для стимуляции работы кишечника, полезнейшие витамины и антиоксиданты.

Также очень много клетчатки в цитрусовых (грейпфрут, апельсин), а еще в качестве вечернего перекуса вполне подойдут небольшое яблоко или груша.

Пожалуй, под серьезным запретом для ужина остаются только исключительно калорийные виноград и бананы.

Грибы

Разумеется, речь не о жареных с картошкой или запеченных в сметане грибах. Если мы говорим об ужине, можно советовать лишь грибы на гриле, отварные (суп-пюре) или тушеные. В этом случае вы и за 100-150 ккал за порцию не «выйдете», и диетическим белком себя обеспечите, и невероятно вкусное блюдо получите.

Само собой, мы перечислили не все варианты полезного ужина. В качестве не вредящей здоровому организму составляющей в нем также могут присутствовать фасоль, чечевица, белый нежирный сыр, даже орехи и цитрусовые (само собой, в разумных количествах). Как видите, комбинировать продукты и составлять разнообразные их сочетания можно достаточно легко – выбрать есть из чего.

Помните главные правила ужина – есть за пару часов до сна, выбирать полезные и легкоусваивающиеся продукты (белок и клетчатку), для порции не выходить за рамки 200 г и 200 ккал. При их соблюдении вы обеспечите организм необходимыми витаминами и микроэлементами и сможете обрести идеальную фигуру без вреда для здоровья – а ни бессонница, ни набор веса вам точно не будут грозить!

Ужин перед сном. 7 продуктов, которые можно есть на ночь | Полезные советы | ЕДА

Многие люди убеждены, что после 18 часов есть категорически запрещено: утверждение, что поздние ужины вредны для здоровья и фигуры, слышал каждый. Диетолог Юлия Манчук, напротив, успокаивает – правильный ужин даже перед сном не нанесет большого урона фигуре и при этом ускорит обмен веществ.

Сбалансированный перекус даже помогает снизить вес. Благодаря ему уровень сахара стабилизируется, а сжигающий жиры гормон «глюкагон» постепенно избавляет человека от лишних килограммов.

«Перекус за час-полтора до сна даже полезен, ведь это помогает поддерживать стабильный уровень сахара в крови, – рассказывает эксперт. – Не нужно обманывать себя, не обращая внимания на чувство голода. Не ложитесь спать на пустой желудок. Важно понимать, что даже во время сна тело продолжает использовать энергию. Вы спите, а калории все равно сжигаются. И организму, как и днем, нужна «подзаправка», чтобы уровень коэффициента полезного действия оставался на уровне».

Какие же продукты можно позволить себе ночью, чтобы сон был сладким?

Белый рис

Зачастую люди, чтобы похудеть, пытаются заменить в своем рационе белый рис на бурый. Диетолог Юлия Манчук уверена: они делают это напрасно! В белом рисе содержится достаточное количество витаминов и минералов, а еще он улучшает качество сна. Эксперт рекомендует съесть 100 граммов отварного риса за час до сна. Только не стоит перебарщивать с приправами или соусами и превращать легкий ужин в настоящий праздник живота!

Суп

Суп тоже входит в список разрешенных блюд для позднего ужина. Секрет прост – любые теплые жидкости оказывают на организм успокаивающее действие. Позвольте себе небольшую порцию куриного бульона или овощного супа. Главное, чтобы его в составе не было чечевицы или фасоли. Эти продукты не подходят для ужина, потому что долго и тяжело перевариваются. Уснуть с ними точно не получится.

Бутерброд 

Бутерброд тоже может быть полезной едой. Не спешите делать себе сэндвич из пшеничной булки с копченой колбасой. Для «вечерних» бутербродов идеально подойдут крекеры из муки грубого помола и отварная грудка индейки или курицы. Добавьте свежую зелень и помидор: у вас получится вкусный, полезный и сытный ужин.

Закуска с сыром

Мясо отварной грудки хорошо сочетается и с сыром. Особенно это полезно тем, кому в течение дня не удалось даже крошки хлеба съесть. Сочетание мяса птицы и сыра – одно из самых правильных. Кроме того, в сыре содержится сложный белок, который дарит человеку чувство насыщения, а также ускоряет метаболизм.

Рыба 

Блюда из рыбы и морепродуктов усваиваются всего за 45 минут, а на «переработку» свинину и говядину у желудка уходит больше пяти часов! А значит, на ночь можно без зазрения совести съедать порцию даже жирной рыбы и быть уверенным, что сон будет спокойным. Сочетание омега-3, жирных кислот и витамина D улучшает качество сна.

Сало

Немногие знают, что от сала невозможно потолстеть – если, конечно, не съедать его килограммами. В сале совсем нет углеводов, которые могут стать причиной лишнего веса.
Небольшой кусочек размером с половину вашего указательного пальца, съеденный на ночь, будет даже на пользу. «В сале много «хорошего» холестерина, необходимого для смазки суставов и упругости кровеносных сосудов», – уточняет эксперт.

Кстати, самое полезное для человека сало – соленое. Ешьте его с чесноком или луком, тогда и от простудных заболеваний получите хорошую профилактику. А вот от жареного или копченого продукта нужно категорически отказаться. В нем нет ничего полезного, а вот токсинов – хоть отбавляй.

Сладости

Вечером иногда так хочется позволить себе хотя бы немного сладкого! Специалист советует обратить внимание на мед, изюм, чернослив и темный шоколад. В них содержание антиоксидантов выше, чем в других сладких продуктах.

Как есть ночью и худеть?

Даже если ваша сила воли зашкаливает, а фигура все больше напоминает идеал, нет абсолютной защиты от ночного жора. Старые привычки или банальная скука могут потянуть вас к холодильнику, и свести все ваши результаты на нет.

Но можно ли сочетать ночные перекусы с похудением? Оказывается, можно. Ночные набеги на холодильник могут никак не повредить вашей фигуре.

Одно исследование 2011 года, опубликованное в журнале «Obesity», обнаружило, что ночной дожор напрямую связан с набором веса. Исследование показало, что ужин после восьми вечера связан с высоким индексом массы тела.

Другое исследование, проведенное через два года, в 2013, показало то же самое — когда участники эксперимента съедали самую большую порцию еды за день до трех дня, они худели быстрее, чем те, что наедались после этого времени.

Исследователи до сих пор не могут дать исчерпывающий ответ, почему поздние ужины провоцируют набор веса, но многие утверждают, что это происходит из-за замедленного метаболизма. Когда тело готовится ко сну, пищеварение замедляется, и обильный ужин прямо перед сном вызывает дискомфорт и мешает хорошо выспаться.

Но, тем не менее, многие эксперты в области диетологии соглашаются, что небольшие порционные закуски, состоящие из здоровой пищи, помогут вам удержаться в норме дневных калорий, и худеть, несмотря на ночные перекусы.

Диетолог Андреа Уилкокс радует любителей поесть ночью:

Если в течение дня вы питаетесь здоровой пищей, не переедаете и не голодаете, здоровые закуски перед сном не принесут вреда.

Также вам может быть просто необходимо перекусить поздно вечером, если вы занимались спортом во второй половине дня.

Правда, есть одна проблема: набрасываясь на еду ночью, мы часто превышаем количество калорий, которое рассчитано на день, и едим не те продукты, даже если они кажутся вполне здоровыми.

Это целое искусство — правильно питаться ночью, чтобы не толстеть.

Что можно есть на ночь?

Диетолог Пегги Короди рекомендует для здоровых ночных перекусов выбирать пищу с содержанием белков и углеводов. При этом надо постараться уложиться в 100-200 калорий.

В ваш ночной рацион могут войти:

  • Орехи и фрукты
  • Крекеры из цельного зерна
  • Нежирные мюсли, заправленные нежирным йогуртом
  • Овсянка с миндальным молоком (можно заменить соевым)
  • Цельнозерновой хлеб с тонкими ломтиками курицы

Это кажется нелогичным, но диетологи не советуют избегать перед сном  пищу с высоким содержанием углеводов.

Углеводы повышают уровень триптофана, незаменимой аминокислоты, которая преобразуется в серотонин.

Это химическое вещество создает ощущение расслабления и благополучия, что поможет вам лучше заснуть.

Если у вас диабет, стоит разработать свое ночное меню вместе с диетологом, чтобы знать, какая еда поможет поддержать стабильный уровень сахара в крови.

Что нельзя есть на ночь

Забудьте о нездоровой пище, которую все едят ночью, и будет вам здоровый, глубокий сон. Каждый раз, схватившись за палку колбасы или запуская ложку в салат, щедро заправленный майонезом, помните, что спать вы будете плохо, а сон имеет огромное значение для потери веса и дневного аппетита.

Слишком много белка и жирной пищи

Высокая концентрация белка содержится в мясе, особенно в красном. Оно требует много энергии для переваривания, что может нарушить сон. Да, белок должен быть в ночном перекусе, но не слишком много. То же самое и насчет жирной пищи (её вообще стоит исключить из ночного рациона).

Никаких сладостей

Избегайте продуктов с низким гликемическим индексом, даже если совсем немного. Они поднимают уровень сахара в крови, и, как следствие, уровень энергии, который потом быстро падает. Это тоже плохо влияет на сон.

Откажитесь от алкоголя

Мало того, что алкоголь вообще плохо влияет на сон, он еще и может привести к ожирению. Просто помните, что когда вы выпили рюмку ли две, ваши запреты если не улетают, то точно ослабевают. «А, черт с ним! Хочу жареный окорок!»

Большие порции

Постарайтесь, чтобы ваш ужин был по крайней мере за три часа до сна, чтобы не хотелось перекусить и помешать этим здоровому и крепкому сну. Если вы плотно поели за час до сна, организм переваривает еду лежа, что замедляет пищеварение и не дает нормально выспаться.

Откажитесь от кофеина

Качество вашего сна напрямую связано с похудением, так что не пейте кофе и газировку после трех вечера и убедитесь, что в вашем ужине его тоже нет. И это касается не только кофе, но и шоколада, как это ни печально.

Как оградить себя от ночных походов на кухню?

Если вы серьезно решили завязать с ночными перекусами, эти советы помогут вам удержать себя подальше от холодильника или по крайней мере подальше от лишнего веса.

Посмотрите, что вы едите днем

Первым делом посмотрите, что вы едите в течение дня, во сколько и как много. Для мониторинга можете даже завести пищевой дневник или использовать специальные приложения для этого. В итоге вы будете знать, сколько белков, жиров, углеводов и натрия потребляет ваш организм в течение дня, и что вы можете съесть поздно вечером, чтобы не испортить свою фигуру.

Тренер по здоровому питанию Милхем Тара советует съедать обильный завтрак, большой обед и немного перекусить перед ужином. Дневник также поможет вам понять, что вы получили все питательные вещества, недостаток которых вполне может потянуть вас на кухню в 10 вечера или ночью.

Пейте больше воды

Убедитесь, что ваш организм получает достаточно воды в течение дня. Выпивайте 2 литра воды в день или больше, если на улице жарко или вы занимаетесь спортом. Обезвоживание может создавать иллюзию голода, которая исчезнет от пары стаканов воды.

Горячие успокаивающие напитки

Диетолог Люси Габель рекомендует во время ночного голода успокаивать себя чашкой горячего травяного чая. Также можно выпить на ночь горячую воду с лимоном, медом, кайенским перцем, корицей и имбирем (компоненты добавлять по вкусу).

«Теплая вода помогает расслабиться, почувствовать спокойствие и удовлетворение, а мед поможет справиться с чувством голода», — объясняет Люси.

Запереть кухню

Это последний способ для тех, кто не может съесть чуть-чуть, и если уж добрался до холодильника, сметает все подряд, буквально запивая шоколадки борщом.

Создайте нерушимое правило: вообще не заходить на кухню после десяти вечера, например, или после восьми.

Занимайтесь чем угодно — читайте, смотрите телевизор, сходите погулять или примите горячую ванну. Можно просто лечь спать, но, конечно, не сразу после ужина.

Если вы устали, сила воли может быть не в лучшем состоянии, так что можно немного отдохнуть, например, подремать.

Может быть, это болезнь?

Для некоторых людей, преимущественно, женщин, ночные набеги на кухню перерастают из дурной привычки в пищевое расстройство. Отсутствие аппетита утром, обильные трапезы после обеда и пробуждение в ночное время с диким, непреодолимым желанием что-нибудь съесть.

Если вы обнаружили в себе такого диетного ликантропа, скорее всего, причины кроются в психологических проблемах и расстройстве пищевого поведения. Можете проконсультироваться с врачом, или просто задуматься, что пошло не так в вашей жизни.

Периодический паралич | Сидарс-Синай

Не то, что вы ищете?

Что такое периодический паралич?

Периодический паралич (ПП) — редкое генетическое заболевание. Вызывает внезапные приступы кратковременная мышечная слабость, скованность или паралич. Эти атаки могут повлиять на весь тело или просто 1 или 2 конечности.

Там представляют собой несколько различных форм полипропилена.Все они связаны с дефектами ионных каналов. Эти находятся шлюзы, которые пропускают заряженные минералы (ионы), такие как натрий и калий, внутрь и из ваших клеток. Этот поток ионов — центральная часть работы ваших мышц. В ПП, в ионные каналы иногда выходят из строя, и мышечные клетки не работают должным образом.

Приступы

PP могут начаться в детстве или в зрелом возрасте. Они могут возникнуть после тяжелых упражнений. или другие триггеры.В зависимости от формы ПП, которая у вас есть, симптомы могут быть такими: легкие или тяжелые, и они могут длиться несколько минут или дней. Иногда болезнь может медленно ухудшаются с течением времени и вызывают необратимое повреждение мышц.

Основные формы ПП:

  • Гипокалиемический полипропилен (гипо относится к низкому содержанию калия). Приступы могут возникнуть из-за низкого уровня в крови калий.Другие триггеры могут включать физические упражнения, продукты с большим содержанием сахара. и крахмалы (углеводы), лакрица, стресс, низкие температуры и некоторые лекарства. Это наиболее распространенная форма полипропилена.
  • Гиперкалиемический полипропилен (гипер относится к высокому уровню калия). Приступы могут быть следствием высокого уровня в крови калий. Другие триггеры могут включать физические упражнения, голодание, стресс, холод и определенные лекарства.
  • Тиреотоксик PP . Приступы могут быть вызваны высоким уровнем гормона щитовидной железы. Проблемы с щитовидной железой: также обычно присутствует. Другие триггеры могут включать упражнения, много еды. углеводы и стресс. Эта форма чаще всего встречается у мужчин, особенно у мужчин. Азиатский фон ..
  • Синдром Андерсена-Тавиля. Приступы могут быть следствием колебаний уровня калия в крови. Триггеры может также включать упражнения, стресс и некоторые лекарства. Многие люди с этой формой ПП обладают определенным набором черт лица. К ним относятся широкий лоб, широко расставленные глаза, низко посаженные уши и небольшой подбородок.

Мост формы ПП влияют на скелетные мышцы . Это мышцы, которые вы контроль, чтобы двигаться.Синдром Андерсена-Тавиля может поражать скелетные мышцы и сердце. мышцы, что делает эту форму ПП более опасной, чем большинство других форм.

Что вызывает периодический паралич?

все разные формы PP являются результатом генетических проблем. Эти проблемы приводят к ионной дефекты канала. Ионные каналы обычно контролируют способ, которым заряженные минералы (ионы) такие как калий, натрий и кальций попадают в мышечные клетки и покидают их.

Каждая мышечная клетка имеет покрытие или мембрану, защищающую внутреннюю часть клетки. Когда нерв заставляет мышечную клетку сокращаться, он посылает химический сигнал, который открывает ворота, позволяющие ионам натрия проникать в ячейку. Прилив заряженных ионов изменяет электрический заряд внутри клетки. Это вызывает волну тока через мышечное волокно. Ионы кальция выходят из мешочков в клетках и заставляют мышечные волокна договор.Калиевые каналы открываются, отправляя ионы калия из клетки. Этот заставляет мышцу сокращаться.

В ПП ионные каналы имеют дефекты, которые могут нарушить процесс. Мышечные клетки затем перестают сокращаться или расслабляться в ответ на нервные сигналы.

Там Есть десятки различных дефектов, которые могут вызвать ПП. Они влияют на натрий, кальций или ионные каналы калия.Также имеется много неопознанных дефектов полипропилена. В большинстве случаев, ты может получить PP, если только один родитель имеет условие.

Каковы симптомы периодического паралича?

Ваши симптомы могут в некоторой степени зависеть от формы вашего полипа. Вы можете сначала заметить симптомы в детстве или в зрелом возрасте. У вас могут быть приступы часто или редко. В некоторых формы PP, у людей, как правило, меньше приступов с возрастом.Обычно люди с ПП могут иметь такие симптомы, как:

  • Приступы мышечной слабости, которые могут длиться от нескольких минут до нескольких дней
  • Мышечная боль в мышцах после нагрузки
  • Спазмы в мышцах
  • Ощущение покалывания
  • Постоянная слабость, более вероятно в более позднем возрасте

Различные формы PP могут вызывать следующее:

  • Гипокалиемия PP часто начинается в позднем детстве или подростковом возрасте.Средний возраст составляет от 5 до 35 лет. Приступы слабости скелетных мышц мая длиться от пары часов до суток. Обычно это происходит ночью или в утро. Вы можете вообще не двигаться во время самых тяжелых эпизодов. После около 50 лет, это может вызвать постоянную слабость, которая постепенно ухудшается, особенно в бедра и бедра.
  • Гиперкалиемический полипропилен часто начинается к 10 годам.Приступы слабости скелетных мышц длятся в среднем 30 дней. минут до 4 часов. Приступы, как правило, бывают частыми, но менее серьезными, чем при других заболеваниях. ПП формы. По мере того, как вы становитесь старше, у вас может быть меньше атак, но у вас также могут быть постоянные повреждение мышц, которое постепенно ухудшается.
  • Тиреотоксик PP обычно начинается в возрасте от 20 до 40 лет. Атаки случаются где угодно от нескольких раз в год до нескольких раз в неделю.Приступы могут длиться от часов до дней. С участием эта форма PP, у вас также могут быть симптомы, связанные с щитовидной железой, такие как беспокойство, потливость, потеря веса и ненормальное ощущение сердцебиения (сердцебиение). У некоторых людей с тиреотоксическим ПП симптомы щитовидной железы отсутствуют. болезнь, особенно на ранней стадии.
  • Синдром Андерсена-Тавиля обычно начинается в возрасте до 18 лет. Приступы длятся от 1 до 36 часов.Эта форма может вызывать нерегулярное сердцебиение, потому что поражает сердечную мышцу вместе с скелетные мышцы

В целом ваши симптомы могут отличаться в зависимости от формы ПП и конкретного изменение гена, которое может у вас быть.

Как диагностируется периодический паралич?

Ваш врач возьмет анамнез.Он или она спросит о ваших недавних симптомах, мимо проблемы со здоровьем и семейный анамнез. Ваш врач проведет медицинский осмотр и оцените свои мышцы. Вам могут понадобиться такие тесты, как:

  • Анализы крови на уровень калия при приступе
  • Другие анализы крови для измерения уровней других минералов и газов крови
  • Генетический анализы крови на известные дефекты PP
  • Нерв исследования проводимости и электромиография для измерения электрической активности мышцы
  • Электрокардиограмма (ЭКГ) для проверки электрической активности сердца
  • Анализы крови на уровень гормонов щитовидной железы

Вы можете сначала обратиться к своему лечащему врачу, а затем получить направление к специализированному неврологу. при таких заболеваниях, как пп.

Как лечится периодический паралич?

Лечение направлено на уменьшение количества и тяжести приступов. Способы управления ПП май включают:

  • Тщательный контроль потребления калия с пищей и добавками
  • IV (внутривенное) лечение калием, если симптомы гипокалиемического ПП тяжелые
  • Контроль углеводов в рационе
  • Контроль функции щитовидной железы.Это очень важно, если у вас тиреотоксический полипропилен.
  • Получение помощь диетолога. Этот эксперт может помочь вам выбрать диету, уменьшающую приступы. уменьшив количество углеводов или минералов.
  • Принимая такие лекарства, как ацетазоламид. Это лекарство может ухудшить PP в некоторых случаях, хотя.
  • Принимая другие лекарства, такие как ингибиторы карбоангидразы или калийсберегающие мочегонные средства
  • Нет получение определенных видов анестезии из-за возможных осложнений
  • Использование сердечное лекарство или кардиостимулятор, если у вас синдром Андерсена-Тавиля
  • Ограничение воздействия триггеров и поддержание умеренного уровня физических упражнений
  • Принимая дихлорфенамид.Это лекарство может уменьшить количество приступов, если у вас гипокалиемический PP.

Вы может потребоваться частый мониторинг для измерения уровня калия в крови. Комбинация из контролируемая диета, лекарства и изменения в образе жизни могут помочь вам справиться с PP.

Ключевые моменты

  • PP — редкое заболевание, вызывающее внезапные временные приступы мышечной слабости, скованность или паралич.
  • PP — это генетическое заболевание, переданное от родителей. Наследование является доминантным, то есть вы есть шанс получить его, если хотя бы один из родителей имеет генетический дефект PP.
  • PP эпизоды могут начаться в детстве или в зрелом возрасте.
  • г. приступы могут быть легкими или тяжелыми и продолжаться в течение нескольких минут или дней.
  • В зависимости от формы полипептида у вас приступы могут быть вызваны низким или высоким содержанием калия. уровни в крови, упражнения, стресс, холод, пища, богатая углеводами, голодание, определенные лекарства или высокий уровень гормонов щитовидной железы.
  • Синдром Андерсена-Тавиля может поражать сердечную мышцу, вызывая нерегулярные сердцебиение.
  • As люди стареют, у них иногда возникают необратимые повреждения мышц.
  • Вы можете используйте комбинацию диеты, лекарств и изменений образа жизни для лечения PP.

Следующие шаги

Советы, которые помогут вам получить максимальную пользу от визита к врачу:

  • Знайте причину вашего визита и то, что вы хотите.
  • Перед визитом запишите вопросы, на которые хотите получить ответы.
  • Возьмите с собой кого-нибудь, кто поможет вам задать вопросы и запомнить, что говорит ваш поставщик ты.
  • Во время посещения запишите название нового диагноза и любые новые лекарства, методы лечения, или тесты. Также запишите все новые инструкции, которые дает вам ваш провайдер.
  • Узнайте, почему прописано новое лекарство или лечение и как они вам помогут.Также знать, каковы побочные эффекты.
  • Спросите, можно ли вылечить ваше состояние другими способами.
  • Знайте, почему рекомендуется тест или процедура и что могут означать результаты.
  • Знайте, чего ожидать, если вы не примете лекарство, не пройдете тест или процедуру.
  • Если у вас назначена повторная встреча, запишите дату, время и цель для этого визит.
  • Знайте, как вы можете связаться с вашим провайдером, если у вас есть вопросы.

Медицинский обозреватель: Энн Феттерман, RN BSN

Медицинский обозреватель: Раймонд Кент Терли BSN MSN RN

© 2000-2021 Компания StayWell, LLC. Все права защищены. Эта информация не предназначена для замены профессиональной медицинской помощи. Всегда следуйте инструкциям лечащего врача.

Не то, что вы ищете?

ночных экспериментов проливают свет на цветение, опосредованное фотопериодом1 | Физиология растений

Аннотация

Растения используют вариацию продолжительности дня (фотопериод), чтобы предвидеть сезонные изменения.Они реагируют, регулируя свой рост и развитие, чтобы максимизировать производство семян, что в случае зерновых культур напрямую связано с урожайностью. У пшеницы ( Triticum aestivum ) ускорение цветения при длинных днях (LD) зависит от световой индукции фитохромами PHOTOPERIOD1 ( PPD1 ). При LD PPD1 активирует FLOWERING LOCUS T1 ( FT1 ), мобильный сигнальный белок, который перемещается от листьев к апикальной меристеме побегов, способствуя цветению.Здесь мы показываем, что прерывание длинных ночей короткими импульсами света («ночной перерыв» [NB]) ускоряет цветение пшеницы, предполагая, что продолжительность ночи имеет решающее значение для фотопериодической реакции пшеницы. PPD1 Транскрипция быстро повышалась с помощью NB, и величина этой индукции возрастала с увеличением продолжительности темноты, предшествующей NB. Циклогексимид отменил повышающую регуляцию NB PPD1 , предполагая, что этот процесс зависит от активного синтеза белка в темноте.В то время как одного NB было достаточно для индуцирования PPD1 , более 15 NB требовалось для индукции высоких уровней экспрессии FT1 и сильного ускорения цветения. Множественные NB не влияли на экспрессию основных генов циркадных часов. Ускорение цветения за счет NB исчезло у нуль-мутантов ppd1-, демонстрируя, что этот ответ опосредован PPD1 . Ускорение цветения было самым сильным, когда NB применялись посреди ночи, что позволяет предположить, что в дополнение к PPD1 , для усиления экспрессии FT1 и ускорения цветения требуются другие контролируемые циркадным ритмом факторы.

Растения могут предвидеть суточные и сезонные колебания окружающей среды и корректировать свой рост и развитие в соответствии с благоприятными условиями. У цветковых растений репродуктивное развитие должно быть оптимальным по времени, чтобы свести к минимуму риск повреждения чувствительных органов цветка поздними заморозками или ранними высокими температурами. Правильный выбор времени этого перехода является основным фактором, определяющим репродуктивный успех, а для зерновых культур, таких как пшеница ( Triticum aestivum ), урожайность зерна.Следовательно, более глубокое понимание регулирования времени цветения может способствовать развитию сортов сельскохозяйственных культур, более приспособленных к разнообразным условиям окружающей среды.

Фотопериодические реакции цветения различаются у разных видов; растения короткого дня (SD) и растения длинного дня (LD) демонстрируют ускоренное цветение в SD и LD соответственно, в то время как растения с нейтральным днем ​​демонстрируют сходные профили цветения независимо от продолжительности дня (Garner and Allard, 1920, 1923). Растения обладают сложными регуляторными механизмами, позволяющими воспринимать изменения фотопериода и реагировать на них, что гарантирует, что цветение происходит только в индуктивных условиях.Регулирование времени цветения с помощью фотопериода лучше всего понимается у Arabidopsis ( Arabidopsis thaliana ), растения LD, у которого фотопериодическая реакция в основном контролируется CONSTANS (CO). Экспрессия CO регулируется циркадными часами и достигает пиков в конце полудня и вечером (Suárez-López et al., 2001). Белок CO дестабилизируется и разлагается в темноте, обеспечивая ограничение активности CO до фотопериодов LD, когда пик транскрипции CO совпадает с внешним светом (Valverde et al., 2004). В этих условиях CO непосредственно активирует экспрессию FLOWERING LOCUS T ( FT ) (Valverde et al., 2004; Tiwari et al., 2010). FT кодирует мобильный сигнальный белок (флориген), гомологичный членам семейства ФОСФАТИДИЛЕТАНОЛАМИН-СВЯЗЫВАЮЩИХ БЕЛКОВ, который синтезируется в листьях и перемещается в апикальную меристему побега через флоэму (Corbesier et al., 2007), где он связывает промотор гена идентичности меристемы APETALA1 и индуцирует цветение (Wigge et al., 2005).

Аналогичным образом гомологи FT у видов трав, таких как рис ( Oryza sativa; дата заголовка 3a [ Hd3a ]) и пшеница ( FT1 или VERNALIZATION3 ), действуют как стимуляторы цветения. По прибытии в апикальную меристему побега FT-подобные белки образуют часть гексамерного комплекса активации цветков, который связывает промоторы генов идентичности меристемы MADS-бокса, вызывая развитие цветения (Taoka et al., 2011; Li et al., 2015) . Сверхэкспрессия FT1 в трансгенных растениях пшеницы приводит к фенотипу раннего цветения даже в неиндуктивных условиях SD, тогда как растения, несущие мутации потери функции в FT1 , проявляют фенотип позднего цветения (Lv et al., 2014).

CO играет роль в фотопериодической реакции у нескольких видов трав, таких как рис (Hayama et al., 2003), сорго ( Sorghum bicolor ; Yang et al., 2014) и ячмень ( Hordeum vulgare ; Campoli et al., 2012; Alqudah et al., 2014). Однако эти виды также обладают дополнительным светопериодным путем, который отсутствует у Arabidopsis, в котором ген PHOTOPERIOD1 ( PPD1 ) играет центральную роль. PPD1 (названный PRR37 в рисе и сорго) кодирует член семейства белков PSEUDO RESPONSE REGULATOR (PRR) и является гомологом генам циркадных часов Arabidopsis PRR3 и PRR7 (Farré and Liu, 2013).Дупликация, которая произошла от PRR3 и PRR7 у Arabidopsis и PRR37 и PRR73 у злаков, являются независимыми, и, следовательно, их субфункционализация независима (Farré and Liu, 2013). У Arabidopsis PRR3 и PRR7 кодируют компоненты циркадных часов, и их нарушение изменяет экспрессию других часовых генов (Farré et al., 2005). Напротив, вариация PPD1 / PRR37 в травах не влияет на периодичность циркадного ответа (Murphy et al., 2011; Shaw et al., 2012). Эти результаты предполагают, что после его дупликации в линии травы PPD1 эволюционировал как ген фотопериода, который функционирует как выходной сигнал циркадных часов.

Большинство естественных вариантов фотопериодического ответа у пшеницы связаны с делециями в промоторах PPD-A1 (Wilhelm et al., 2009) или PPD-D1 (Beales et al., 2007) или с различиями в PPD-B1 Номер копии (Díaz et al., 2012). Делеции промотора в аллелях Ppd-A1a или Ppd-D1a связаны с неправильной экспрессией PPD1 в течение ночи, индукцией FT1 и ускорением цветения при SD (Beales et al., 2007; Вильгельм и др., 2009). Растения, несущие эти аллели, по-прежнему зацветают раньше при LD, чем при SD, и поэтому будут называться аллелями «сниженного фотопериодического ответа» (а не «нечувствительными к фотопериоду» аллелями).

Ускорение цветения PPD1 требует его транскрипционной активации светом, которая опосредуется двумя членами семейства фитохромов, PHYB и PHYC (Chen et al., 2014; Pearce et al., 2016). Фитохромы максимально поглощают свет в красном (R) и дальнем красном (FR) спектре и существуют в виде двух взаимозаменяемых изоформ: неактивной формы R, поглощающей свет, синтезируемой в цитоплазме, и активной формы FR, поглощающей свет, Pfr, которая перемещается в ядро (Nagatani, 2004; Rockwell et al., 2006). По прибытии в ядро ​​фитохромы Pfr взаимодействуют с белками bHLH, известными как ФАКТОРЫ, ВЗАИМОДЕЙСТВУЮЩИЕ С ФИТОХРОМОМ (PIF), что инициирует каскад светорегулируемых сигнальных путей (Leivar and Monte, 2014). В темноте и под воздействием света FR фитохромы Pfr переходят в неактивную форму Pr.

Несмотря на молекулярную характеристику некоторых компонентов PPD1 -зависимого пути цветения у пшеницы, все еще существуют большие пробелы в наших знаниях о механизмах, участвующих в световой регуляции PPD1 и FT1 и восприятие фотопериодических различий.В этом исследовании мы охарактеризовали реакцию пшеницы при воздействии коротких импульсов света в течение длинных ночей фотопериодов SD, которые в дальнейшем называются ночными перерывами или NB. NB: эксперименты имеют то преимущество, что изменяют световые периоды без изменения общего количества часов света, получаемого растением.

NB вызывают значительную задержку цветения при применении к растениям SD, выращиваемым в условиях SD (Hamner and Bonner, 1938; Coulter and Hamner, 1964; Lumsden and Furuya, 1986; Ishikawa et al., 2005). Наибольшее торможение цветения (далее NBmax) происходит, когда NB вносятся посреди ночи (Thomas and Vince-Prue, 1997). Эти наблюдения демонстрируют, что продолжительность ночи имеет решающее значение для регулирования времени цветения у многих SD-растений и что реакция NB может быть охарактеризована как переходный период чувствительности к свету, который тормозит цветение. У риса одного NB было достаточно для подавления цветения при SD посредством PHYB-опосредованной репрессии транскрипции Hd3a (Ishikawa et al., 2005; Исикава и др., 2009). Эти наблюдения согласуются с моделью цветения внешнего совпадения, согласно которой цветение индуцируется, когда внешний свет и внутренние колебательные циркадные сигналы совпадают (Bünning, 1936; Pittendrigh and Minis, 1964).

В этом исследовании мы показываем, что NB ускоряют цветение у растений пшеницы, выращенных в условиях SD, и что реакция наиболее сильна в середине ночи. Используя нуль-мутанты ppd1-, мы демонстрируем, что этот ответ опосредуется PPD1. Мы также показываем, что хотя транскрипция PPD1 быстро индуцируется в течение 1 часа после воздействия одного NB, для индукции FT1 до высоких уровней и для раннего цветения требуется несколько NB. Наконец, мы показываем, что величина индукции PPD1 в ответ на NB увеличивается в соответствии с продолжительностью темноты, предшествующей световому сигналу, и что эта индукция зависит от активного синтеза белка в темноте.

РЕЗУЛЬТАТЫ

NB вызывают экспрессию

PPD-B1 и FT1 и ускоряют цветение у чувствительной к фотопериоду пшеницы

Почти изогенные растения тетраплоидного сорта пшеницы Kronos, несущие чувствительный к фотопериоду аллель Ppd-A1b (далее Kronos-PS), быстро растут (в среднем 52.8 d) в фотопериоде LD (16 часов света при 22 ° C / 8 часов темноты при 17 ° C), но демонстрируют большие задержки в дате заголовка (> 150 дней; рис. 1A) при выращивании в фотопериоде SD (8 часов света / 16 ч темнота). Когда длинные ночи SD прерывались 1-часовыми импульсами белого света в разные моменты ночи (NB), цветение растений Kronos-PS ускорялось (рис. 1A).

Рисунок 1.

Влияние NB на время колошения и экспрессию генов времени цветения у растений Kronos-PS ( Ppd-A1b ).A, время колошения растений, выращенных после прорастания в условиях SD, LD и NB. Растения подвергали воздействию НБ в течение 1 часа после 2-14 часов темноты, как указано. В одном эксперименте 15-минутный NB применялся после 8 часов темноты. Время заголовка указывается в днях до заголовка ± стандартная ошибка ( n > 5). Различные буквы рядом с полосами обозначают значительную разницу между режимами лечения ( P <0,05, тест Тьюки). B – D: экспрессия генов времени цветения в листьях 6-недельных растений, выращенных с момента прорастания в условиях SD и NBmax.В, ППД-А1 ; С, PPD-B1 ; D, экспрессия FT1 , представленная в кратности уровней ACTIN . Растения Kronos-PS выращивали в течение 6 недель либо в условиях SD, либо в условиях NB с импульсом света, подаваемым через 8 часов темноты. Образцы собирали непосредственно перед NB (T1), сразу после NB (T2), затем через 3 (T3) и 5 ​​ч (T4) после начала NB. * P <0,05, ** P <0,01 и *** P <0,0001.

Рисунок 1.

Влияние NB на время колошения и экспрессию генов времени цветения в растениях Kronos-PS ( Ppd-A1b ). A, время колошения растений, выращенных после прорастания в условиях SD, LD и NB. Растения подвергали воздействию НБ в течение 1 часа после 2-14 часов темноты, как указано. В одном эксперименте 15-минутный NB применялся после 8 часов темноты. Время заголовка указывается в днях до заголовка ± стандартная ошибка ( n > 5). Различные буквы рядом с полосами обозначают значительную разницу между режимами лечения ( P <0.05, тест Тьюки). B – D: экспрессия генов времени цветения в листьях 6-недельных растений, выращенных с момента прорастания в условиях SD и NBmax. В, ППД-А1 ; С, PPD-B1 ; D, экспрессия FT1 , представленная в кратности уровней ACTIN . Растения Kronos-PS выращивали в течение 6 недель либо в условиях SD, либо в условиях NB с импульсом света, подаваемым через 8 часов темноты. Образцы собирали непосредственно перед NB (T1), сразу после NB (T2), затем через 3 (T3) и 5 ​​ч (T4) после начала NB.* P <0,05, ** P <0,01 и *** P <0,0001.

Выбор времени NB оказал сильное влияние на дату заголовка с максимальным ускорением (NBmax), когда NB применялся посреди ночи (после 8 часов темноты). В этих условиях растения вырастают всего на 7 дней позже, чем растения, выращенные в фотопериоде LD (рис. 1А). НБ, примененные ранее или позже этого момента, оказали более слабое влияние на дату колошения, хотя среди растений, подвергшихся воздействию НБ после 6, 8 или 10 часов темноты, дата колошения существенно не отличалась ( P > 0.05; Рис. 1А). 15-минутные NB, введенные после 8 часов темноты, были столь же эффективны для ускорения цветения, как и 1-часовые NB, примененные одновременно (рис. 1A).

Чтобы охарактеризовать транскрипционные ответы, связанные с ускоренным цветением в NB, мы сравнили уровни экспрессии выбранных генов времени цветения в 6-недельных растениях, выращенных с момента прорастания в условиях NBmax, с теми, которые поддерживаются в фотопериоде SD. Поскольку аллельные вариации в локусах PPD1 могут влиять на экспрессию каждого гомеолога в отдельности, мы измерили уровни транскриптов PPD-A1 и PPD-B1 с помощью анализов, специфичных для гомеологов.Для всех других мишеней использовались количественные анализы обратной транскрипции (qRT) -PCR, которые амплифицируют гомеологи A и B (дополнительная таблица S1).

В растениях Kronos-PS, выращенных на SD, уровни экспрессии PPD-A1 и PPD-B1 оставались низкими в течение ночи, а транскриптов FT1 не были обнаружены ни в одной из проанализированных временных точек (рис. Б – Г). В растениях, выращенных в условиях NB после прорастания, уровни транскрипта PPD-A1 удвоились в ответ на NB, но этот гомеолог экспрессировался на очень низких уровнях во всех исследуемых временных точках (<0.1-кратный ACTIN ; Рис. 1Б). Напротив, уровни транскрипта PPD-B1 были примерно в 20 раз выше, чем PPD-A1 до NB (временная точка T1) и в 26 раз выше после NB (временная точка T2), что позволяет предположить, что PPD-B1 homeolog вносит вклад в большинство транскриптов PPD1 и в чувствительной к фотопериоду тетраплоидной пшенице. Этот результат согласуется с предыдущим исследованием гексаплоидного сорта пшеницы Paragon, где PPD-B1 составляло 90% всех транскриптов PPD1 (Shaw et al., 2012).

Экспрессия PPD-B1 была значительно выше ( P <0,01) в NB, чем в условиях SD, во все моменты времени и быстро повышалась под действием NB, достигая пика между 1 и 3 часами после начала NB (рис. . 1С). Уровни транскрипта FT1 были значительно выше в условиях NB (от 10 до 20 раз ACTIN ), чем в SD ( P <0,05), и показали повышенную экспрессию через 5 ч после начала NB (рис. 1D). . Даже до воздействия NB уровни транскрипта FT1 и были значительно выше в растениях, выращенных в условиях NB с момента прорастания, чем в растениях, выращенных в условиях SD (момент времени T1; фиг. 1D).

FLOWERING LOCUS T2 ( FT2 ) и VERNALIZATION1 уровни экспрессии также были повышены в растениях, выращенных в NB, в то время как экспрессия FLOWERING LOCUS T3 ( FT3 ) была снижена по сравнению с растениями, выращенными в SD (Supplemental Рис. S1, A – C). Эти результаты показывают, что регуляция транскрипции этих генов времени цветения в NB сходна с их регуляцией в фотопериодах LD (Lv et al., 2014).

Аллель

Ppd-A1a с пониженной чувствительностью к фотопериоду снижает влияние NB на время направления

Затем мы изучили NB-ответ у растений пшеницы, несущих аллель Ppd-A1a , который снижает чувствительность к фотопериоду за счет ускорения цветения при SD (Wilhelm et al., 2009). При LD эти растения возглавили на 26,2 дня раньше ( P <0,001), чем при SD, показывая, что они все еще имеют некоторую чувствительность к фотопериоду (рис. 2A). Однако различия в дате колошения между LD и SD были значительно уменьшены по сравнению с различиями в линиях Kronos-PS, выращенных в тех же условиях (задержка> 95 дней; Рис. 1A). Эта пониженная чувствительность к фотопериоду также отразилась на отклике NB. Растения, выращенные с момента прорастания в разных NB, показали ускоренное цветение по сравнению с SD, но время NB меньше влияло на дату колошения, чем в линиях Kronos-PS (рис.2А).

Рисунок 2.

NB-ответ у растений Kronos, несущих аллель Ppd-A1a , придающий пониженную чувствительность к фотопериоду либо с диким типом, либо с мутантным PHYB ( phyB -null) или PHYC аллелями ( phyC ). -нулевой). A, время заголовка дикого типа, мутантов phyB -null и phyC -null в условиях SD и LD и в ответ на NB, применяемые в разное время ночи (2–14 ч, как указано).Различные буквы рядом с полосами обозначают значительную разницу между режимами лечения ( P <0,05, критерий Тьюки). Уровни экспрессии (B) PPD-A1 , (C) PPD-B1 и (D) FT1 в ответ на NB в листьях 6-недельного дикого типа, phyB -null и phyC -нулевых растений, о которых сообщалось в виде уровней ACTIN . Растения выращивали в течение 6 недель в условиях NB с импульсом света, подаваемым через 8 часов темноты. Моменты выборки для анализа экспрессии показаны внизу рисунка, а также описаны в легенде рисунка 1.* P <0,05. нс, не имеет значения.

Рисунок 2.

NB-ответ у растений Kronos, несущих аллель Ppd-A1a , придающий пониженную чувствительность к фотопериоду с диким типом или мутантом PHYB ( phyB -null) или PHYC аллелей ( phyC). -ноль). A, время заголовка дикого типа, мутантов phyB -null и phyC -null в условиях SD и LD и в ответ на NB, применяемые в разное время ночи (2–14 ч, как указано).Различные буквы рядом с полосами обозначают значительную разницу между режимами лечения ( P <0,05, критерий Тьюки). Уровни экспрессии (B) PPD-A1 , (C) PPD-B1 и (D) FT1 в ответ на NB в листьях 6-недельного дикого типа, phyB -null и phyC -нулевых растений, о которых сообщалось в виде уровней ACTIN . Растения выращивали в течение 6 недель в условиях NB с импульсом света, подаваемым через 8 часов темноты. Моменты выборки для анализа экспрессии показаны внизу рисунка, а также описаны в легенде рисунка 1.* P <0,05. нс, не имеет значения.

В 6-недельных растениях Ppd-A1a , выращенных с момента прорастания в условиях NBmax, уровни транскриптов PPD-A1 в течение ночи были примерно в 10 раз выше, чем у PPD-B1 (момент времени T1, генотип дикого типа; рис. 2, B и C), что подтверждает предыдущие результаты (Wilhelm et al., 2009). FT1 также экспрессировался на высоких уровнях до NB (~ 3-кратный ACTIN ) у этих растений (фиг. 2D).После NB экспрессия PPD-A1 была снижена, но оставалась выше, чем PPD-B1 (> 1-кратное ACTIN ) во всех проанализированных временных точках (фиг. 2B). И PPD-B1 , и FT1 проявляли аналогичные профили индукции в ответ на NB (фиг. 2, C и D), как и в линиях Kronos-PS (фиг. 1, C и D).

Ускорение цветения посредством NB требует как PHYB, так и PHYC

Ускорение цветения в фотопериоды LD требует активности как PHYB, так и PHYC (Chen et al., 2014; Pearce et al., 2016), поэтому мы затем протестировали NB-ответ у мутантов Kronos, несущих нефункциональные копии обоих гомеологов PHYB ( phyB -null) или PHYC ( phyC -null). Все растения в этом эксперименте несли аллель Ppd-A1a , обеспечивающий пониженную чувствительность к фотопериоду. При SD-фотопериодах мутанты phyB -null и phyC -null проявляли фенотипы очень позднего цветения по сравнению с контрольной линией дикого типа (рис.2А). Воздействие NB не влияло на дату заголовка у мутантов phyB -null и приводило к задержке заголовка на 27,2 дня у мутантов phyC -null ( P = 0,018; фиг. 2A).

Затем мы изучили транскрипционные ответы PPD1 и FT1 у этих мутантов после NB. PPD-A1 был экспрессирован как в мутантах phyB -null, так и в phyC -null во все моменты времени, но был значительно ниже у мутантов, чем у растений дикого типа в моменты времени T2 и T3 ( P < 0.05; Рис. 2Б). Уровни транскрипта PPD-B1 были значительно ниже у обоих мутантов по сравнению с диким типом в моменты времени T2, T3 и T4 ( P <0,001; фиг. 2C) и не повышались в ответ на NB. Несмотря на относительно высокие уровни транскрипта PPD-A1 в нуль-мутантах phyB -null и phyC- в несколько временных точек (рис. 2B), FT1 не экспрессировался ни в одном из мутантов (рис. 2D). . Эти результаты демонстрируют, что и PHYB, и PHYC необходимы для индукции PPD-B1 и FT1 посредством NB.

Ускорение цветения NB частично подавляется световой обработкой FR

Фитохромы активируются и инактивируются после воздействия света R и FR, соответственно, поэтому мы проверили влияние обработки светом FR на реакцию NB. Растения Kronos-PS выращивали в двух различных условиях от прорастания. В одной камере растения подвергали воздействию 1-часового NB после 8 часов темноты, а в другой камере растения подвергали воздействию тех же условий, за исключением того, что 1-часовой NB сопровождался 30-минутным импульсом FR-света.Растения, подвергшиеся воздействию света FR, показали задержку в сроке колошения на 8,9 дня по сравнению с контрольными растениями, но разница не была значимой ( P = 0,19; фиг. 3A).

Рис. 3.

Влияние световой обработки FR на время движения и экспрессию PPD-B1 . A, Время колошения растений Кронос-ПС в ответ на обработку FR. Свет FR применялся либо в виде 30-минутного блока сразу после 1 часа NB (30 минут FR), либо в виде 15-минутных импульсов белого света, интеркалированных с 15-минутными импульсами FR-света (импульсный FR). PPD-B1 экспрессия в B, 30 мин FR или C, импульсная обработка FR. * P <0,05, ** P <0,01 и *** P <0,001.

Рис. 3.

Влияние световой обработки FR на время заголовка и экспрессию PPD-B1 . A, Время колошения растений Кронос-ПС в ответ на обработку FR. Свет FR применялся либо в виде 30-минутного блока сразу после 1 часа NB (30 минут FR), либо в виде 15-минутных импульсов белого света, интеркалированных с 15-минутными импульсами FR-света (импульсный FR). PPD-B1 экспрессия в B, 30 мин FR или C, импульсная обработка FR. * P <0,05, ** P <0,01 и *** P <0,001.

Одной из возможных причин слабого воздействия этой обработки FR на дату колошения могло быть то, что воздействия белого света в течение 1 часа было достаточно для необратимой активации нижестоящих генов или белков в пути индукции цветения до инактивации FR светом растения фитохромы. Чтобы проверить эту возможность, мы применили NB в виде 15-минутных импульсов белого света, интеркалированных либо с 15-минутными периодами темноты (контрольная камера), либо с 15-минутными импульсами FR-света (FR-камера).Применение NB с использованием этого протокола было менее эффективным для ускорения курса, чем когда NB давался в виде 1-часового блока белого света, но обработка FR имела пропорционально больший эффект и значительно задерживала дату заголовка (средняя задержка 22,5 дня, P = 0,012; рис. 3А). На уровне транскрипции экспрессия PPD-B1 была значительно снижена только при импульсной обработке FR ( P <0,01 в последних трех временных точках; фиг. 3, B и C). Эти результаты предполагают, что, несмотря на абсолютную потребность в функциях PHYB и PHYC для ответа NB, условия освещения FR, использованные в этих экспериментах, были недостаточными для полного устранения ответа NB.

Ускорение цветения по NB Требуется PPD1

Чтобы определить важность PPD1 для ответа NB, мы сравнили нуль-мутантные линии дикого типа и ppd1-, лишенные всех функциональных копий PPD1 в чувствительной к фотопериоду гексаплоидной разновидности Paragon (Shaw et al., 2013 ) и тетраплоидной линии Кронос-ПС (разработанной в данном исследовании; см. «Материалы и методы»). Сначала мы измерили дату колошения у этих линий при выращивании в условиях SD или LD с момента прорастания.В условиях SD ни дикий тип, ни нулевые мутанты ppd1- любого сорта не зацвели в течение 150 дней, когда эксперимент был прекращен (фиг. 4A). В условиях LD мутанты ppd1 -null оказались на 60 и 34 дня позже, чем линии Kronos-PS и Paragon-PS дикого типа соответственно (фиг. 4A).

Рис. 4.

Ответ NB у ppd1 нулевых растений. A, дата заголовка для мутантов дикого типа и ppd1 -null, выращенных с момента прорастания в условиях SD или LD.B, дата заголовка для мутантов дикого типа и ppd1 -null в условиях NB. Растения выращивали в условиях SD в течение 4 недель перед переводом в условия NBmax. Использованы изогенные линии в фонах тетраплоидного Kronos и гексаплоидного Paragon. Все эксперименты прекращали через 150 дней. Экспрессия PPD-B1 (C) и FT1 (D) в кратности — Уровни ACTIN в Kronos-PS и Kronos ppd1 — нулевых растениях, выращенных в течение 10 недель в условиях SD или в течение 4 недель в условиях SD с последующими 6 неделями в условиях NBmax.Образцы собирали непосредственно перед NB (T1), сразу после NB (T2), затем через 3 часа после начала NB (T3) и в сумерках следующего дня. * P <0,05, ** P <0,01 и *** P <0,0001.

Рис. 4.

Ответ NB у ppd1 нулевых растений. A, дата заголовка для мутантов дикого типа и ppd1 -null, выращенных с момента прорастания в условиях SD или LD. B, дата заголовка для мутантов дикого типа и ppd1 -null в условиях NB.Растения выращивали в условиях SD в течение 4 недель перед переводом в условия NBmax. Использованы изогенные линии в фонах тетраплоидного Kronos и гексаплоидного Paragon. Все эксперименты прекращали через 150 дней. Экспрессия PPD-B1 (C) и FT1 (D) в кратности — Уровни ACTIN в Kronos-PS и Kronos ppd1 — нулевых растениях, выращенных в течение 10 недель в условиях SD или в течение 4 недель в условиях SD с последующими 6 неделями в условиях NBmax. Образцы собирали непосредственно перед NB (T1), сразу после NB (T2), затем через 3 часа после начала NB (T3) и в сумерках следующего дня.* P <0,05, ** P <0,01 и *** P <0,0001.

В отдельном эксперименте с немного другими условиями (растения сначала выращивали при SD в течение 4 недель перед переходом в условия NBmax) мы сравнили эффект NBmax в чувствительных к фотопериоду линиях и линиях нулевых мутантов ppd1-. Растения Kronos-PS и Paragon-PS в среднем развивались через 73 дня и 91 день при NB, соответственно, но ни одна линия ppd1 -нулевая не зацвела в течение 150 дней, когда эксперимент был прекращен (рис.4Б). Эти результаты показали, что PPD1 играет основную роль во влиянии NB и LD на время заголовка.

Затем мы проанализировали уровни транскриптов PPD-B1 и FT1 в растениях Kronos-PS и ppd1 -null в четырех временных точках, включая сумерки, когда эти гены времени цветения обычно экспрессируются на высоких уровнях при LD (Chen и др., 2014). Растения выращивали в SD в течение 4 недель, затем либо поддерживали в условиях SD, либо переводили в условия NBmax на 6 недель.В растениях Kronos-PS уровни транскрипта PPD-B1 и были повышены через 1 час и 3 часа после начала NB (аналогично фиг. 1C и 2C) и до еще более высоких уровней в сумерках (фиг. 4C). В растениях Kronos-PS, содержащихся в SD, уровни транскрипта PPD-B1 не были активированы в течение ночи, но показали повышение в сумерках, хотя уровни были значительно ниже ( P = 0,04), чем у растений, которые подвергались воздействию несколько NB (рис. 4C). Как и ожидалось, транскрипты PPD-B1 в нулевых мутантах Kronos ppd1- не были обнаружены ни в условиях SD, ни в условиях NB, что подтверждает специфичность праймеров qRT-PCR, используемых в этом анализе (рис.4С). В соответствии с предыдущими результатами, транскриптов FT1 не были обнаружены в растениях Kronos-PS при SD, но были сильно активированы в условиях NB во все моменты времени ( P <0,001; фиг. 4D). Однако в нуль-мутанте ppd1- транскрипты FT1 не были обнаружены ни в одной из выбранных временных точек, включая сумерки, ни в SD, ни в NB условиях.

PPD1 и FT1 по-разному реагируют на NB

Чтобы исследовать влияние одиночных NB на активацию транскрипции PPD1 и FT1 с более высоким разрешением в течение первого часа NB, мы выращивали растения Kronos-PS в течение 4 недель в фотопериодах SD, прежде чем подвергать их однократному воздействию. NB.Непосредственно перед воздействием NB экспрессия PPD-B1 была очень низкой (<0,1-кратная ACTIN ), но быстро увеличивалась между 30 мин и 1 часом (фиг. 5A). Уровни транскрипта достигли пика через 3 часа после начала NB, а затем снизились через 2 часа (временной момент 5 часов; рис. 5A). Эффект NB на экспрессию PPD-B1 через 1, 3 и 5 ч после NB был подобен паттерну, наблюдаемому у 6-недельных растений, выращенных под NB с момента прорастания (фиг. 1C). Мы также наблюдали аналогичный профиль транскрипции PPD-B1 в ответ на 15-минутный NB (рис.5Б). Однако быстрая индукция PPD-B1 не отражалась на уровнях транскрипта FT1 , которые оставались низкими во все анализируемые моменты времени после одного NB (фиг. 5, A и B).

Рисунок 5.

Транскрипционный ответ PPD-B1 и FT1 на один и несколько NB. Уровни экспрессии PPD-B1 и FT1 в растениях Kronos-PS в ответ на один 1 час (A) или 15 минут (B) NB. C, транскрипция PPD-B1 , FT1 и ZCCT2 и (D) время колошения растений, подвергшихся воздействию разного количества NB.Растения Kronos-PS выращивали в условиях SD в течение 4 недель, подвергали воздействию различного количества NB через 8 часов темноты и после этого возвращали в условия SD. E. Влияние продолжительности темноты перед одиночным NB на индукцию PPD-B1 . Растения Kronos-PS выращивали в течение 4 недель в SD и подвергали воздействию одного NB на разных стадиях ночи. Ткань листьев собирали через 3 ч после начала НБ. F. Влияние обработки циклогексимидом на индукцию PPD-B1 в ответ на NB (4-недельные растения Kronos-PS в воде или гидропонных растворах циклогексимида).Половину растений держали в темноте, а половину подвергали 1-часовому NB. Ткань листьев собирали непосредственно перед NB (T1) и через 3 часа после начала NB (T2). Все данные по экспрессии представлены в виде уровней ACTIN .

Рисунок 5.

Транскрипционный ответ PPD-B1 и FT1 на один и несколько NB. Уровни экспрессии PPD-B1 и FT1 в растениях Kronos-PS в ответ на один 1 час (A) или 15 минут (B) NB.C, транскрипция PPD-B1 , FT1 и ZCCT2 и (D) время колошения растений, подвергшихся воздействию разного количества NB. Растения Kronos-PS выращивали в условиях SD в течение 4 недель, подвергали воздействию различного количества NB через 8 часов темноты и после этого возвращали в условия SD. E. Влияние продолжительности темноты перед одиночным NB на индукцию PPD-B1 . Растения Kronos-PS выращивали в течение 4 недель в SD и подвергали воздействию одного NB на разных стадиях ночи.Ткань листьев собирали через 3 ч после начала НБ. F. Влияние обработки циклогексимидом на индукцию PPD-B1 в ответ на NB (4-недельные растения Kronos-PS в воде или гидропонных растворах циклогексимида). Половину растений держали в темноте, а половину подвергали 1-часовому NB. Ткань листьев собирали непосредственно перед NB (T1) и через 3 часа после начала NB (T2). Все данные по экспрессии представлены в виде уровней ACTIN .

Шестинедельные растения Kronos-PS, выращенные с момента прорастания под NB, показали значительно повышенную экспрессию как PPD-B1 , так и FT1 в темноте перед NB (момент времени T1 на рис.1, C и D), предполагая, что транскрипты этих генов могут накапливаться в ответ на множественные NB. Поэтому мы измерили уровни экспрессии PPD-B1 и FT1 в ответ на увеличение количества NB путем анализа уровней транскриптов непосредственно перед NB. Хотя уровни транскрипта PPD-B1 были немного повышены в образцах, подвергнутых воздействию более чем трех NB, по сравнению с растениями, поддерживаемыми в условиях SD, мы не нашли убедительных доказательств увеличения экспрессии PPD-B1 в ответ на увеличение количества NB (фиг.4C и 5C). Напротив, уровни транскрипта FT1 , которые не определялись после первых трех последовательных NB, демонстрировали постепенное повышение после шести NB и значительное увеличение после 18 NB (фиг. 5C). Мы также протестировали уровни экспрессии ZCCT2 (функциональная копия VERNALIZATION2 в Kronos), LD-репрессора FT1 (Yan et al., 2004; Distelfeld et al., 2009), и не обнаружили никаких транскрипционных изменений с увеличивающееся количество NB (рис. 5C).

Более значительное увеличение уровней транскрипта FT1 после 18 NB было связано с ускорением времени заголовка (рис.5D). Растения, подвергшиеся воздействию 21 NB, были первыми (в среднем 88,7 дня), за ними следовали растения, подвергшиеся воздействию 18 NB (99 дней) и 15 NB (105,8 дня; рис. 5D). Растения, подвергнутые воздействию менее 15 NB, не развились в течение 150 дней (рис. 5D). Чтобы проанализировать развитие колоса в этих последних образцах, мы выделили по одному растению из каждого класса и измерили длину колоса. Растения, получившие ноль, три или шесть NB, находились на ранних стадиях развития колоса (<5 мм), тогда как растения, получившие девять NB, были более продвинутыми (> 15 мм; дополнительный рис.S2).

Постепенное ускорение времени колошения у растений, подвергшихся воздействию увеличивающегося количества NB, было аналогично ускорению, наблюдаемому после увеличения количества LD (дополнительный рисунок S3). Однако эффект воздействия LD был сильнее, чем эффект после воздействия NB. Для начала ускорения цветения требовалось меньше LD, чем NB, и ускорение было сильнее после 20 LD (дополнительный рис. S3), чем после 21 NB (рис. 5D). Этот результат согласуется с нашим предыдущим экспериментом, показывающим, что растения, выращенные в условиях LD с момента прорастания, зацвели на ~ 7 дней раньше, чем растения, выращенные в условиях NBmax с момента прорастания (рис.1А).

PPD-B1 Для индукции NB требуется активный синтез белка в темноте

Затем мы проверили влияние времени введения NB на индукцию PPD-B1 , подвергая выращенные SD растения воздействию одного NB в разное время ночи. Мы предположили, что максимальная индукция PPD-B1 будет совпадать с самым сильным ускорением даты заголовка (то есть после 8 часов темноты). Эта гипотеза оказалась неверной, и вместо этого мы обнаружили, что PPD-B1 индуцировался до все более высоких уровней в соответствии с продолжительностью темного периода, предшествующего NB (рис.5E).

Сначала мы подумали, что постепенное накопление неактивных фитохромов Pr в ядре в результате темновой реверсии может объяснить повышенную индукцию PPD-B1 с более длительными периодами темноты. Однако растения, обработанные светом FR непосредственно перед нанесением NB через 2 часа темноты, не проявляли повышенной экспрессии PPD-B1 (дополнительный рисунок S4). Этот результат предполагает, что накопление фитохромов Pr в ядре не является ответственным за прогрессирующую индукцию PPD-B1 с продолжительными периодами темноты.

Затем мы подумали, что индукция PPD-B1 может быть связана с синтезом de novo фитохромов или других промежуточных белков в темноте. Чтобы проверить эту гипотезу, мы выращивали растения Kronos-PS в гидропонном растворе и обрабатывали половину из них циклогексимидом, чтобы блокировать синтез белка, и оставили половину растений без обработки в качестве контроля. В соответствии с предыдущими результатами, контрольные растения, находящиеся в темноте, не показали индукции PPD-B1 , тогда как растения, подвергшиеся воздействию одного NB, продемонстрировали сильную повышающую регуляцию экспрессии PPD-B1 через 2 часа после NB (момент времени T2; фиг. .5F). Индукция PPD-B1 в ответ на NB была отменена у растений, обработанных циклогексимидом (фиг. 5F), что демонстрирует, что экспрессия PPD1 в ответ на свет требует активного синтеза белка в темноте. Этот эксперимент был проведен дважды с идентичными результатами.

Множественные NB не изменили SD-захват генов циркадных часов

Наконец, мы проверили, достаточно ли воздействия нескольких NB для изменения SD-вовлечения генов ядра циркадных часов.Растения Kronos-PS выращивали в течение 7 недель в SD или в течение 4 недель в SD, а затем в течение 3 недель в условиях NBmax. Через 7 недель все растения были переведены в автономные условия (постоянный свет и температура) на 24 часа, а затем образцы листьев отбирали с 4-часовыми интервалами в течение дополнительного 24-часового периода автономного режима. Профили экспрессии PRR59 , PRR95 , PRR73 , CIRCADIAN CLOCK ASSOCIATED1 , GIGANTEA ( GI ) и TIMING OF CAB EXPRESSION1 SD- растений не показали значимых различий между выращенными растениями NB-EXPRESSION1 и SD-. во всех выбранных временных точках (дополнительный рис.S5, A – F). Эти результаты предполагают, что NB имеют ограниченное влияние на профили экспрессии основных генов циркадных часов. В том же эксперименте уровни транскрипта PPD-B1 и были выше в растениях, ранее выращенных под NB, чем в растениях, ранее выращенных под SD (дополнительный рис. S5G). Различия были особенно большими в субъективных сумерках, что согласуется с результатами, наблюдаемыми на рисунке 4C. FT1 Уровни транскрипта всегда были высокими в образцах из растений, выращенных в среде NB, но почти не обнаруживались у растений, ранее выращенных в среде SD (дополнительный рис.S5H). Этот результат подтвердил, что 2 суток при непрерывном освещении недостаточно для повышающего регулирования FT1.

ОБСУЖДЕНИЕ

Ответы NB в растениях SD и LD

Многие исследования с использованием NB для характеристики влияния изменения фотопериодов на время цветения были сосредоточены на SD-растениях, в основном потому, что ингибирование цветения NB оказалось более простой системой исследования, чем ускорение цветения NB у LD-растений (Thomas and Винс-Прю, 1997).Наша характеристика реакции NB у пшеницы подчеркивает некоторые сходства и различия между этими двумя системами.

У многих SD-растений цветение подавляется NB и рисом; этот эффект связан с подавлением транскрипции Hd3a (ортологичной FT ) (Ishikawa et al., 2005). Когда растения риса перемещаются из NB обратно в индуктивные фотопериоды SD, это ингибирование теряется, и экспрессия Hd3a возвращается к высоким уровням. У пшеницы NB также влияют на экспрессию FT1 и время цветения, хотя эти ответы обратные.Эти результаты позволяют предположить, что как растения SD, так и LD оба реагируют на NB посредством регуляторных механизмов, действующих на экспрессию FT . Противоположный эффект NB на экспрессию FT и цветение у риса и пшеницы, вероятно, определяется противоположной ролью PPD1 (= PRR37 в рисе и сорго) у разных видов трав. В травах LD, таких как пшеница и ячмень, PPD1 индуцирует FT1 и ускоряет цветение (Turner et al., 2005; Shaw et al., 2013), тогда как в травах SD, таких как сорго и рис, PRR37 подавляет FT- , как гены, и задерживает цветение (Murphy et al., 2011; Ку и др., 2013).

Ответы NB у трав SD и LD также различаются по их ответу на свет FR после NB. У некоторых растений SD подавление цветения одним световым светом R NB полностью обратимо при немедленном воздействии света FR (Downs, 1956; Cathey and Borthwick, 1957). У пшеницы мы обнаружили, что однократное воздействие FR после NB оказало ограниченное влияние на время колошения (рис. 3A). Одноминутные импульсы FR после 1-минутных импульсов белого света были более эффективными (задержка курса 22,5 дня), но не полностью отменяли ускорение курса NB (рис.3А). Частичное влияние света FR на ускорение цветения NB согласуется с предыдущими результатами для травяного ячменя LD (Downs, 1956).

Наконец, рис и пшеница различаются по роли PHYC в реакции NB. У риса NB-ответ полностью устраняется у растений, несущих мутации потери функции PHYB , но на него не влияют аналогичные мутации в PHYC (Ishikawa et al., 2005, 2009). Напротив, у пшеницы NB-ответ отсутствует как у нулевых мутантов phyB- , так и у нулевых мутантов phyC- (рис.2). Различные роли PHYC в NB параллельны различным ролям, которые этот фитохром играет в фотопериодической реакции пшеницы и риса. PHYC является положительным регулятором времени цветения у некоторых трав умеренного климата, таких как пшеница, ячмень и Brachypodium distachyon (Nishida et al., 2013; Chen et al., 2014; Woods et al., 2014), но имеет ограниченное значение или нет. влияние на время цветения риса и арабидопсиса (Monte et al., 2003; Takano et al., 2005; Hu et al., 2013). Эти результаты предполагают, что PHYC играет более важную роль в фотопериоде и реакции NB у трав умеренного пояса LD, чем у других видов растений.

Для индукции цветения пшеницы требуется несколько NB

В то время как одного NB достаточно для подавления цветения риса (Ishikawa et al., 2005) и стимулирования цветения у Lolium temulentum cv Ceres (Evans, 1958), для ускорения цветения многих трав умеренного климата требуется несколько LD (Heide, 1994). Большинство трав умеренного климата демонстрируют некоторое ускорение цветения после воздействия 4-8 фотопериодов LD, но для полного насыщения этой реакции требуется 12-16 дней воздействия LD (Heide, 1994).Эти результаты согласуются с нашими наблюдениями для пшеницы, где от 6 до 10 LD вызывали умеренное ускорение цветения, но наибольшее ускорение цветения наблюдалось у растений, подвергшихся воздействию 12 или более LD (дополнительный рис. S3). Ускорение времени колошения в ответ на увеличение количества NB было аналогично тому, которое наблюдалось в ответ на увеличение количества LD, но эффекты были меньше, и для инициирования ускорения цветения требовалось не менее 15 NB (рис. 5D). Эти результаты согласуются с существованием независимого фотопериодного пути PPD1-, который может быть более чувствительным к LDs, чем к NB.

У Arabidopsis индукция перехода от вегетативного к репродуктивному верхушкам также требует циклов индукции FT , повторяемых в течение нескольких дней. Однако, в то время как от 4 до 5 LD достаточно для насыщения ускорения цветения у Arabidopsis, для пшеницы требуется более 20 LD (Krzymuski et al., 2015). Возможные объяснения потребности в нескольких NB или LD для индукции FT1 в пшенице включают постепенное накопление промотора цветения, постепенное уменьшение репрессора цветения или постепенное изменение эпигенетических меток в некоторых из вовлеченных генов.Не было обнаружено корреляции между количеством NB и уровнями транскрипта ZCCT2 (репрессор FT1 ), что позволяет предположить, что этот ген не является критическим для наблюдаемых изменений в FT1 на этом генетическом фоне (рис. 5C). Точно так же уровни транскрипта PPD1 не увеличивались в ответ на множественные NB, что указывает на то, что предполагаемый фактор накопления вряд ли является регулятором транскрипции PPD1 . Однако все еще возможно, что количество NB влияет на уровни активного белка PPD1.Чтобы проверить эту гипотезу, мы начали создание трансгенных растений пшеницы, экспрессирующих HA-меченный белок PPD1. Также возможно, что белки, отличные от PPD1, также играют роль в регуляции FT1 в ответ на множественные NB.

Индукция

PPD-B1 светом увеличивается в ночное время

Интересно, что мы обнаружили, что величина индукции PPD-B1 NB была пропорциональна длине темноты, предшествующей NB.Это явление, по-видимому, не связано с накоплением белка фитохрома Pr, возникающим в результате темновой реверсии, поскольку воздействие света FR до введения NB (ожидается, что увеличится пул фитохромов Pr) не повлияло на последующую индукцию PPD1 светом ( Дополнительный рис. S4). Вместо этого мы обнаружили, что обработка растений циклогексимидом в течение ночи отменяет повышающую регуляцию NB PPD1 (рис. 5F), что предполагает, что индукция PPD1 светом зависит от активного синтеза белка в темноте.

Одна возможность состоит в том, что синтез de novo изоформ Pr PHYB и / или PHYC в темноте коррелирует с силой индукции PPD1 . Во время более длительных периодов темноты вновь синтезированные белки PHYB и PHYC будут накапливаться до более высоких уровней, так что последующие световые сигналы приведут к более сильной индукции PPD1 . Альтернативной возможностью является синтез de novo и накопление в темноте PHYB / PHYC-индуцированного фактора транскрипции, необходимого для активации PPD1. Это может включать один или несколько PIF, которые, как было показано, в некоторых случаях действуют как коактиваторы светоиндуцированных генов (Leivar and Monte, 2014). Для проверки этих гипотез и идентификации синтезированного в темноте белка, ответственного за повышенную активацию PPD1 при более длительных периодах темноты, потребуются дополнительные эксперименты.

Влияние NB на время цветения, вероятно, обусловлено одним или несколькими генами, регулируемыми циркадными часами

Несмотря на более сильную индукцию NB PPD1 после более длительных периодов темноты, уровни транскрипта PPD1 не коррелировали напрямую с датой заголовка.Наибольшее влияние NB на дату заголовка наблюдалось, когда NB было приурочено к середине ночи, даже несмотря на то, что уровни транскрипции PPD1 были ниже в этот момент, чем после применения NB позже ночью. Эта зависимость от времени ночи предполагает, что активность PPD1 может управляться генами, регулируемыми циркадными часами. Существование стробирующего механизма также подтверждается тем фактом, что, хотя транскрипция PPD1 индуцируется во время световых фаз как SD, так и LD, транскрипция FT1 наблюдается только в фотопериодах LD (Beales et al., 2007; Вильгельм и др., 2009). Более того, ритмическая чувствительность к цветению, вызванному NB, наблюдалась и у других трав LD (Thomas and Vince-Prue, 1997). L. temulentum cv Церера, цветение которых вызывается одним циклом LD, демонстрирует две фазы высокой чувствительности к NB, когда растения, выращенные на SD, помещают в постоянную темноту. Первая фаза произошла между 4 и 8 часами от начала периода темноты, а вторая — примерно на 20-24 часа позже, что предполагает участие циркадного ритма в контроле цветения у L.temulentum (Périlleux et al., 1994). Подобные эксперименты было бы сложно провести с пшеницей из-за необходимости наличия нескольких NB для стимулирования цветения.

Возникает соблазн предположить, что регуляция экспрессии FT1 с помощью PPD1 может функционировать аналогично регуляции FT с помощью CO у Arabidopsis. У Arabidopsis FT индуцируется только в условиях LD, когда пик транскрипции CO совпадает со светом, который необходим для стабилизации белка CO (Valverde et al., 2004). У пшеницы индукция и цветение FT1 могут быть определены по совпадению внешнего сигнала (световая активация транскрипции PPD1 посредством PHYB / PHYC) с внутренним ритмом, опосредованным циркадными часами.

Помимо этой предполагаемой роли в блокировании эффекта PPD1 , известно, что циркадные часы участвуют в регуляции экспрессии PPD1 (Beales et al., 2007; Chen et al., 2014; Alvarez et al. др., 2016). Растения, несущие мутации потери функции в EARLY FLOWERING3 (компонент вечернего комплекса циркадных часов), демонстрировали повышенную экспрессию PPD1 и более раннее цветение при LD и SD (Alvarez et al., 2016). Сходные результаты наблюдались у мутантов LUX ARRHYTHMO диплоидной пшеницы, другого компонента вечернего комплекса (Gawrónski et al., 2014). Эти результаты предполагают, что у злаков с умеренным климатом вечерний комплекс циркадных часов действует как репрессор транскрипции PPD1 (Campoli et al., 2013; Alvarez et al., 2016). Интересно, что два LUX-связывающих сайта (GATWCG; Chow et al., 2012) присутствуют в промоторе PPD1 , включая один в области, удаленной в аллеле Ppd-A1a .

Было показано, что у ячменя изменения фотопериода быстро влияют на экспрессию генов циркадных часов (Deng et al., 2015). Однако мы не наблюдали значительных изменений в профилях экспрессии любого из основных генов циркадных часов после 21 NB, предполагая, что изменения в часах играли ограниченную роль в индукции цветения NB (дополнительный рис. S5). Более того, сильная задержка времени заголовка, наблюдаемая у нуль-мутантов Kronos и Paragon ppd1- при NBmax, продемонстрировала, что PPD1 является основным фактором ускорения времени заголовка NB.Это не исключает возможности того, что циркадные часы могут играть важную роль в регуляции промежуточных стадий между индукцией PPD1 и FT1 или в независимом пути фотопериода PPD1- в умеренных травах.

Рабочая модель для

PPD1 Регулирование реакции фотопериода у пшеницы

В этом исследовании мы показываем, что хотя одного NB длительностью всего 15 минут достаточно для индукции PPD1 , пик экспрессии наблюдается только через 3 часа после NB (рис.5А). Эта временная шкала событий предполагает, что дополнительные молекулярные стадии могут быть вовлечены в активацию транскрипции PPD1 после первоначального короткого воздействия белого света. Ранее было показано, что NB-ответы бывают быстрыми, и NB в течение 2 минут на красный свет, как было показано, достаточно для ускорения цветения (Downs, 1956; Cathey and Borthwick, 1957).

Короткая длина светового импульса, необходимая для запуска реакции NB, согласуется с ролью фитохромов на начальных этапах реакции NB.У Arabidopsis преобразование фитохромов из форм Pfr в формы Pr происходит в течение 5 минут после воздействия R-светом с высокой яркостью, а 2-минутной обработки R-светом достаточно, чтобы инициировать фосфорилирование PIF, которые являются прямыми мишенями активированных фитохромов (Park et al. ., 2004; Шен и др., 2007, 2008; Аль-Сади и др., 2008). Фосфорилированные PIF нацелены на деградацию протеасомой 26S, запуская нижестоящие транскрипционные ответы в течение 15 минут после световых сигналов (Hwang and Quail, 2008).Промежуток времени между воздействием света и повышающей регуляцией уровней транскрипта PPD1 (фиг. 5A) предполагает существование промежуточных молекулярных стадий. Основываясь на участии PHYB и PHYC пшеницы в световой активации транскрипции PPD1 (Chen et al., 2014; Pearce et al., 2016) и известных взаимодействий между фитохромами и PIFs у Arabidopsis, мы предполагаем, что деградация один или несколько PIF, действующих как репрессоры транскрипции PPD1 , могут участвовать в световой активации этого гена.Предполагаемый сайт связывания PIF присутствует в области промотора PPD1 , который удален в аллеле Ppd-A1a (который проявляет экспрессию в течение ночи). Согласно этой гипотезе, применение FR после NB снижает уровни Pfr и ограничивает деградацию этого предполагаемого PIF (ов), тем самым поддерживая некоторую репрессию транскрипции PPD1 (фиг. 3C).

Хотя NB не полностью имитируют отклик LD, между этими двумя процессами есть несколько общих черт, особенно в фотопериодическом отклике, зависящем от PPD1 .Оба процесса зависят от опосредованной PHYB / PHYC световой активации PPD1 , оба процесса требуют нескольких индуктивных циклов для ускорения цветения, и как в NB, так и в растениях, несущих аллель Ppd-A1a , экспрессия PPD1 во время ночь ассоциируется с ускоренным цветением. Основываясь на этом сходстве и на предыдущих исследованиях, мы предлагаем предварительную рабочую модель для PPD1- зависимой фотопериодической регуляции цветения пшеницы (рис.6). Согласно этой модели цветение ускоряется только тогда, когда индуцированная светом экспрессия PPD1 совпадает с экспрессией и / или активностью одного или нескольких регулируемых циркадным ритмом факторов, необходимых для индукции FT1 . При LD, но не при SD, экспрессия PPD1 совпадает с предполагаемым дополнительным фактором, индуцирующим экспрессию FT1 (фиг. 6, A и B). Когда NB вносят в середине ночи, индуцированная светом экспрессия PPD1 совпадает с пиком предполагаемого дополнительного фактора, что приводит к максимальной активации FT1 и раннему цветению (рис.6С). Хотя NB, примененные раньше или позже этой точки, все еще приводят к индукции PPD1 , эти NB больше не совпадают с пиком предполагаемого регулируемого циркадным ритмом фактора, необходимого для активации FT1 . У Arabidopsis чувствительность реакции цветения к индукции экспрессии FT наиболее эффективна, когда FT искусственно индуцируется вечером и ранней ночью (Krzymuski et al., 2015), что позволяет предположить, что время FT индукция также может нести информацию, относящуюся к ускорению цветения.

Рисунок 6.

Рабочая модель фотопериодной индукции цветения пшеницы. Индукция FT1 и ускорение цветения происходит максимально, когда индуцированная светом экспрессия PPD1 совпадает с активностью фактора, регулируемого циркадными часами. A, в SD, экспрессия PPD1 падает в темноте перед пиком активности предполагаемого компонента, в отличие от LD (B), где экспрессия PPD1 совпадает с этим пиком, вызывая FT1 и цветение.Экспрессия PPD1 также совпадает с этим компонентом, когда NB вводится посреди ночи (C), тогда как NB, примененный ранее (D), приводит к уменьшению перекрытия PPD1 с этим предполагаемым фактором и оказывает меньшее влияние на время цветения. E, Аллель Ppd-A1a , обеспечивающий пониженную чувствительность к фотопериоду, неправильно экспрессируется в темноте, что приводит к активации FT1 и цветению даже в SD.

Рисунок 6.

Рабочая модель фотопериодной индукции цветения пшеницы.Индукция FT1 и ускорение цветения происходит максимально, когда индуцированная светом экспрессия PPD1 совпадает с активностью фактора, регулируемого циркадными часами. A, в SD, экспрессия PPD1 падает в темноте перед пиком активности предполагаемого компонента, в отличие от LD (B), где экспрессия PPD1 совпадает с этим пиком, вызывая FT1 и цветение. Экспрессия PPD1 также совпадает с этим компонентом, когда NB вводится посреди ночи (C), тогда как NB, примененный ранее (D), приводит к уменьшению перекрытия PPD1 с этим предполагаемым фактором и оказывает меньшее влияние на время цветения.E, Аллель Ppd-A1a , обеспечивающий пониженную чувствительность к фотопериоду, неправильно экспрессируется в темноте, что приводит к активации FT1 и цветению даже в SD.

Другие исследования подтверждают гипотезу о том, что время индукции PPD1 имеет решающее значение для цветения. У растений пшеницы, несущих аллель Ppd-A1a , придающий пониженную чувствительность к фотопериоду, PPD1 экспрессируется в темноте (Turner et al., 2005; Beales et al., 2007; Вильгельм и др., 2009). Следовательно, даже в неиндуктивных SD-фотопериодах, экспрессия PPD1 совпадает с пиковой активностью предполагаемого регулируемого циркадным ритмом фактора, необходимого для активации FT1 и индукции цветения (рис. 6E). Этот последний результат предполагает, что световые стимулы не требуются для индукции FT1 и цветения, когда PPD1 неправильно экспрессируется в течение ночи. Однако как в мутантах phyB -null, так и у phyC -null мутантов относительно высокие уровни транскрипта PPD-A1a были недостаточны для индукции FT1. Возможное объяснение этого наблюдения состоит в том, что PHYB и PHYC важны для некоторых промежуточных молекулярных стадий, необходимых для активации FT1 с помощью PPD1 . Измененная экспрессия генов основных часов у мутанта phyC -null также может вносить вклад в этот эффект (Chen et al., 2014).

Предполагаемый дополнительный фактор, необходимый для индукции FT1 , вероятно, регулируется циркадными часами, его экспрессия или активность достигают пика между 6 и 10 часами после наступления сумерек при стандартном фотопериоде 16 часов темноты.Этот предполагаемый фактор может функционировать для стабилизации или активации белка PPD1 или быть дополнительным фактором, который действует либо в комплексе с PPD1, либо ниже PPD1, чтобы активировать FT1 . Альтернативно, PPD1 может активировать белок, который разрушает репрессор FT1 или вызывать эпигенетические изменения в FT1 или других промежуточных генах. Идентификация этого предполагаемого регулируемого часами фактора, участвующего в активации PPD1 FT1 , является нерешенным вопросом о PPD1-опосредованном фотопериодическом ответе у пшеницы.

ЗАКЛЮЧЕНИЕ

В этом исследовании мы продемонстрировали, что продолжительность темного периода, а не светового периода, имеет решающее значение для фотопериодической реакции у пшеницы. Мы показали, что PPD1 играет центральную роль в ускорении времени заголовка NB и что этот ответ требует функциональных генов PHYB и PHYC и активной трансляции белка в темноте. У пшеницы индукция FT1 была выше с увеличением количества NB или LD, что свидетельствует о постепенном накоплении сигнала с дополнительными NB или LD.Время индукции NB PPD1 также влияет на интенсивность ускорения цветения, предполагая, что индукция PPD1 FT1 может управляться генами, регулируемыми циркадными часами. Таким образом, описанные здесь эксперименты с NB дают ценную информацию о регуляторных механизмах, контролирующих фотопериодический ответ пшеницы.

МАТЕРИАЛЫ И МЕТОДЫ

Растительные материалы

Эксперименты выполнены на тетраплоидной твердой пшенице ( Triticum turgidum subsp. durum ) сорт Kronos и гексаплоидная мягкая пшеница ( Triticum aestivum subsp. aestivum ) сорт Paragon. Kronos имеет привычку к весеннему росту и несет аллель Ppd-A1a , который имеет делецию в промоторной области, что приводит к снижению чувствительности к фотопериоду за счет ускорения цветения при SD (Wilhelm et al., 2009). Мы разработали почти изогенную линию Kronos, несущую чувствительный к фотопериоду аллель Ppd-A1b дикого типа (Kronos-PS), который очень поздно цветет при SD.Эта линия была получена путем скрещивания Kronos с тетраплоидным сортом твердых пород Langdon (который несет аллель Ppd-A1b ) и выполнения трех обратных скрещиваний с использованием Kronos в качестве рекуррентного родителя, как описано ранее (Pearce et al., 2013). Мы также разработали вторую почти изогенную линию Kronos без функциональных аллелей PPD1 , обозначенную в дальнейшем как ppd1- null. Сначала мы интрогрессировали делецию PPD-B1 из γ-мутанта Paragon (Shaw et al., 2013) на Кроноса тремя обратными скрещиваниями. Затем мы скрестили эту линию с линией Kronos TILLING, несущей мутацию, кодирующую преждевременный стоп-кодон в кодирующей области PPD-A1 (W154 *). Эта мутация устраняет 514 из 668 аминокислот этого белка, включая высококонсервативный домен CCT, который, как было показано, необходим для фотопериодного ответа (Turner et al., 2005). Эта мутантная линия была сначала дважды скрещена с Kronos для уменьшения фоновых мутаций. В потомстве F2 мы отобрали растения, гомозиготные по двум мутациям, используя молекулярные маркеры.Мутантный аллель PPD-A1 был обнаружен с помощью маркера dCAPs. ПЦР выполняли (35 циклов по 94 ° C 20 с, 55 ° C 30 с, 72 ° C 30 с) с использованием прямого праймера AACGAGCTTAAGAACCACTG и обратного праймера TATAATAATCACACACGTTG для амплификации фрагмента длиной 215 п.н. Этот фрагмент расщепляли Bsr . Растения, гомозиготные по нефункциональному аллелю PPD-A1 , показали образец переваривания 195/20 п.н. при прогоне на 1% агарозном геле, тогда как продукты ПЦР, амплифицированные из растений, гомозиготных по аллелю дикого типа, не были переварены и показали интактный 215 п.н. -bp группа.Чтобы обнаружить делецию PPD-B1 , мы использовали анализ Taqman, как описано ранее (Díaz et al., 2012). В данном исследовании использовались линии F4 от двух независимых кроссов. Мы также включили чувствительный к фотопериоду гексаплоид Paragon и его изогенный нуль-мутант ppd1-, несущий делеции или мутации с потерей функции, во все три гомеолога PPD1 , которые были описаны ранее (Shaw et al., 2013).

Мутанты phyB -null и phyC -null были получены путем объединения нефункциональных мутаций в гомеологах A и B каждого гена в линиях Kronos, несущих аллель Ppd-A1a (Chen et al., 2014; Pearce et al., 2016).

Условия роста

Все эксперименты проводились в контролируемых условиях окружающей среды с использованием камер роста PGR15 или E7 / 2 (Conviron), которые были расположены в одной комнате. Во время периода включения освещения камеры для выращивания были установлены на 22 ° C, но первый и последний час этого периода включения освещения были установлены на 20 ° C, чтобы обеспечить более постепенное изменение температуры. Ночная температура была установлена ​​на уровне 17 ° C. Во всех камерах PGR15 использовались одинаковые металлогалогенные и натриевые лампы высокого давления, и во всех экспериментах свет был настроен на одинаковую интенсивность (∼260 мкм · м -2 с -1 ; настройка Conviron 2 для обоих типов ламп) .Свет был включен в течение 8 часов в экспериментах SD и 16 часов в экспериментах LD. В экспериментах NB свет был включен в течение 7 часов, а затем в течение 1 часа посреди ночи, что дало такое же количество света в течение 8 часов. Для эксперимента, проверяющего влияние времени включения NB, 1-часовой световой перерыв применялся через 2, 4, 6, 8, 10, 12 и 14 часов после наступления сумерек.

Эксперименты с применением FR-света были выполнены в двойных камерах для выращивания E7 / 2, оснащенных люминесцентными лампами (250 мкм · м -2 с -1 ), дополненными двумя полосами светодиодных ламп, излучающих FR-свет (~ 720 нм при 100 нм). % интенсивности).В этих экспериментах использовались те же условия выращивания (22 ° C днем ​​/ 17 ° C ночью, включая 1-часовой переходный период при 20 ° C). В первом эксперименте за 1-часовым NB, нанесенным в середине 16-часовой ночи (17 ° C), последовал 30-минутный импульс света FR со 100% -ной интенсивностью. Во втором эксперименте NB состояли из 15-минутных импульсов белого света, интеркалированных либо 1 минутой темноты (контроль), либо 1 минутой FR при 100% интенсивности. Дата колошения измерялась как количество дней от прорастания до полного появления основного колоса.

Чтобы определить влияние различного количества NB или LD на время колошения, растения Kronos-PS выращивали в условиях SD в течение 4 недель, прежде чем растения были переведены в условия LD или NB. Через указанное количество дней растения возвращали в условия SD. Эксперименты прекращали через 150 дней.

Для эксперимента с суточным ритмом времени растения Kronos-PS выращивали в условиях SD в течение 4 недель, а затем половину растений переводили в условия NBmax (15 минут NB после 8 часов темноты), в то время как оставшиеся растения поддерживали. в условиях SD.Эти фотопериоды поддерживались в течение 21 дня, когда обе камеры были переведены в автономный режим (постоянный свет и температура). После 24 часов в автономных условиях ткани листьев собирали из шести биологических повторов с 4-часовыми интервалами в течение дополнительного 24-часового периода.

Гидропонный эксперимент с циклогексимидом

Через неделю после прорастания проростки Kronos-PS пересаживали в гидропонную систему с раствором Хогланда (Hoagland and Arnon, 1950) и выращивали в условиях SD в течение 4 недель.Раствор Хогланда меняли два раза в неделю. Непосредственно перед началом ночи 28-го дня в условиях SD две партии из шести растений были перенесены в 1-литровые химические стаканы с водой (контроль), а две партии из шести растений были перенесены в химический стакан с 500 мкм циклогексимидом (CHX ). Растения из одной партии воды и одной партии CHX оставляли в темноте (no-NB), в то время как растения из другой партии воды и CHX подвергали воздействию 1-часового импульса белого света после 6 часов темноты. Ткани листьев собирали в двух временных точках: непосредственно перед началом NB (T1) и через 2 часа после окончания NB (T2).

qRT-PCR

Экспрессионный анализ выполняли с использованием середины листовой пластинки последнего полностью проросшего листа каждого растения, которые собирали и немедленно замораживали в жидком азоте. При отборе образцов растений в темноте сбор урожая проводился как можно быстрее без дополнительного освещения в помещении, чтобы избежать воздействия внешнего света. Чтобы изучить эффект увеличения количества NB, образцы листьев собирали непосредственно перед NB у растений, подвергшихся воздействию различного количества NB (т.е.е. образец трех NB собирали в темноте непосредственно перед воздействием четвертого NB).

Собранные листья измельчали ​​до тонкого порошка в жидком азоте и экстрагировали РНК с использованием набора Spectrum Plant Total RNA (Sigma-Aldrich). Один микрограмм кДНК был синтезирован из РНК с использованием набора для обратной транскрипции High Capacity (Applied Biosystems) в соответствии с инструкциями производителя. В каждой реакции qRT-PCR использовалось 10 нг кДНК и 1 × мастер-микс qPCR VeriQuest Fast SYBR Green (Affymetrix), за исключением эксперимента с циркадными часами, в котором использовался мастер-микс PowerUP SYBR Green qPCR (Thermo Fisher).

Праймеры

были сконструированы в областях, консервативных между гомеологами A- и B-генома, за исключением PPD-A1 и PPD-B1 , для которых использовали гомеолог-специфические праймеры. Праймеры для всех генов-мишеней и контрольных генов были описаны ранее, а полная информация представлена ​​в дополнительной таблице S1. Реакции qRT-PCR выполняли с использованием системы 7500 Fast Real-Time PCR (Applied Biosystems), за исключением циркадного эксперимента, который проводили с использованием системы QuantStudio 3 Real-Time PCR (Applied Biosystems).Эндогенный контрольный ген для всех реакций — ACTIN . Уровни транскрипта выражаются в виде линеаризованной кратности — уровней ACTIN , рассчитанных по уравнению 2 ( ACTIN CT — TARGET CT) ± SE среднего и представляют собой отношение между исходными количество молекул целевого гена и количество молекул ACTIN (шкалы сопоставимы по генам и экспериментам).

Регистрационный номер

Данные последовательности из этой статьи можно найти в библиотеках данных GenBank / EMBL под номерами доступа ▪▪▪.

Дополнительные данные

Доступны следующие дополнительные материалы.

БЛАГОДАРНОСТИ

Мы благодарим д-ра Джоанну Шмитт и д-ра Дэна Ранси за предоставленный доступ к камерам роста и советы по экспериментальной установке. Мы также благодарим доктора Кларка Лагариаса и доктора Вей Ху из Калифорнийского университета в Дэвисе за серию полезных обсуждений при разработке экспериментов и интерпретации результатов этого проекта и Эмили Квач за отличную техническую поддержку.

Глоссарий

  • FR

  • NB

ЦИТИРОВАННАЯ ЛИТЕРАТУРА

Al-Sady

B

,

Kikis

EA

,

Monte

E

,

Quail

PH

(

2008

)

Механистическая двойственность функции транскрипционного фактора в сигнализации

.

Proc Natl Acad Sci USA

105

:

2232

2237

Alqudah

AM

,

Sharma

R

,

Pasam

RK

,

Graner

A

,

Kilian

B

,

Schnurbusch

000

000

000

0005 фотопериодической реакции на основе GWAS длительности фазы перед цветением ярового ячменя

.

PLoS One

9

:

e113120

Alvarez

MA

,

Tranquilli

G

,

Lewis

S

,

Kippes

N

,

Dubcovsky Ear

J

(

) физическое отображение

2016 se локус Eps-A ( m ) 1 в Triticum monococcum идентифицирует RARLY FLOWERING 3 ( ELF3 ) в качестве гена-кандидата

.

Funct Integr Genomics

16

:

365

382

Beales

J

,

Turner

A

,

Griffiths

S

,

Snape

JW

,

Laurie

DA-

(регулятор давления

2007 Audo 90) — это регулятор давления

2007 9000p. у нечувствительного к фотопериоду мутанта Ppd-D1a пшеницы ( Triticum aestivum L.)

.

Theor Appl Genet

115

:

721

733

Bünning

E

(

1936

)

Die endogen tagesrhthmik als grundlage der photoperiodischen reaktion

.

Ber Dtsch Bot Ges

54

:

590

607

Campoli

C

,

Drosse

B

,

Searle

I

,

Coupland

G

,

von Korff

M

(

Функциональные характеристики

) ячмень ( Hordeum vulgare ) время цветения ортолог CONSTANS.

Завод J

69

:

868

880

Campoli

C

,

Pankin

A

,

Drosse

B

,

Casao

CM

,

Davis

SJ

,

von Korff

HvLUX1 является геном-кандидатом, лежащим в основе локуса ранней зрелости 10 ячменя: Филогения, разнообразие и взаимодействия с циркадными часами и фотопериодическими путями

.

Новый Фитол

199

:

1045

1059

Cathey

HM

,

Borthwick

HA

(

1957

)

Фотообратимость инициации цветков у хризантемы

.

Бот Газ

119

:

71

76

Chen

A

,

Li

C

,

Hu

W

,

Lau

MY

,

Lin

H

,

Rockwell

NC

,

NC

,

Jernstedt

JA

,

Lagarias

JC

,

Dubcovsky

J

(

2014

)

Фитохром C играет важную роль в ускорении цветения пшеницы в условиях фотопериода длинного дня

.

Proc Natl Acad Sci USA

111

:

10037

10044

Chow

BY

,

Helfer

A

,

Nusinow

DA

,

Kay

SA

(

2012

)

Для набора участников ELF3 в промоутер Arabidops Evening Complex PRR9 требуются другие 9019 циркадные часы

.

Сигнальное поведение предприятия

7

:

170

173

Corbesier

L

,

Vincent

C

,

Jang

S

,

Fornara

F

,

Вентилятор

Q

,

Searle

I

Фаррона

S

,

Gissot

L

,

Turnbull

C

и др.(

2007

) Движение белка

FT способствует передаче сигналов на большие расстояния при индукции цветков Arabidopsis.

Наука

316

:

1030

1033

Coulter

MW

,

Hamner

KC

(

1964

)

Фотопериодическая реакция цветения сои Biloxi в 72-часовых циклах

.

Plant Physiol

39

:

848

856

Deng

W

,

Clausen

J

,

Boden

S

,

Oliver

SN

,

Casao

MC

,

Ford

B

Trevaskis

B

(

2015

)

Состояния суточного осциллятора на рассвете и в сумерках у прорастающих сеянцев ячменя ( Hordeum vulgare )

.

PLoS One

10

:

e0129781

Díaz

A

,

Zikhali

M

,

Turner

AS

,

Isaac

P

,

Laurie

DA

(

период 2012

фото)
и Vernalization-A1 Гены связаны с изменением времени цветения у пшеницы ( Triticum aestivum )

.

PLoS One

7

:

e33234

Distelfeld

A

,

Tranquilli

G

,

Li

C

,

Yan

L

,

Dubcovsky

J

(

20094

молекулярная характеристика) loci у тетраплоидной пшеницы

.

Plant Physiol

149

:

245

257

Даунс

RJ

(

1956

)

Фотообратимость зарождения цветков

.

Plant Physiol

31

:

279

284

Эванс

LT

(

1958

)

Lolium temulentum L., растение длинного дня, требующее только одного индуктивного фотоцикла

.

Природа

182

:

197

198

Farré

EM

,

Harmer

SL

,

Harmon

FG

,

Yanovsky

MJ

,

Kay

SA

(

2005 909 и 909

907 909 и 909 и PR

) PRR9 в циркадных часах Arabidopsis

.

Curr Biol

15

:

47

54

Фарре

EM

,

Liu

T

(

2013

)

Семейство регуляторов транскрипции PRR отражает сложность и эволюцию циркадных часов растений

.

Curr Opin Plant Biol

16

:

621

629

Гарнер

WW

,

Аллард

HA

(

1920

)

Влияние относительной продолжительности дня и ночи и других факторов окружающей среды на рост и размножение растений

.

J Сельское хозяйство

18

:

553

606

Гарнер

WW

,

Аллард

HA

(

1923

)

Дальнейшие исследования фотопериодизма, реакции растений на относительную продолжительность дня и ночи

.

J Сельское хозяйство

23

:

871

920

Gawroński

P

,

Ariyadasa

R

,

Himmelbach

A

,

Poursarebani

N

,

Kilian

B

el

0005,

0005 Hensel

G

,

Kumlehn

J

,

Sehgal

SK

и др.(

2014

)

Искаженные циркадные часы вызывают раннее цветение и температурно-зависимые колебания в развитии колосьев у мутанта Eps-3A m пшеницы einkorn

.

Генетика

196

:

1253

1261

Hamner

KC

,

Bonner

J

(

1938

)

Фотопериодизм в отношении гормонов как факторов зарождения и развития цветков

.

Бот Газ

100

:

388

431

Hayama

R

,

Yokoi

S

,

Tamaki

S

,

Yano

M

,

Shimamoto

K

(

2003

Day Control производит

2003

фото) цветение риса

.

Природа

422

:

719

722

Хайде

OM

(

1994

)

Контроль цветения и размножения трав умеренного пояса

.

Новый Фитол

128

:

347

362

Hoagland

DR

,

Arnon

DI

(

1950

)

Метод водного культивирования для выращивания растений без почвы

.

Калифорнийская сельскохозяйственная экспериментальная станция

,

Том 347

.

Сельскохозяйственный колледж Калифорнийского университета

,

Берекели, Калифорния

, стр.

1

32

Hu

W

,

Franklin

KA

,

Sharrock

RA

,

Jones

MA

,

Harmer

SL

,

Lagarias

2013 Регламент

JC роли для фитохромов Arabidopsis , выявленные с помощью анализа нуль-мутантов

.

Proc Natl Acad Sci USA

110

:

1542

1547

Hwang

YS

,

Quail

PH

(

2008

)

Регулируется фитохромом PIL1 дерепрессия модулируется в процессе развития

.

Физиология растительных клеток

49

:

501

511

Ishikawa

R

,

Shinomura

T

,

Takano

M

,

Shimamoto

K

(

2009

)

Фитохромно-зависимый контроль количественного определения 3a эффект цветения риса

.

Гены Genet Syst

84

:

179

184

Исикава

R

,

Тамаки

S

,

Йокои

S

,

Инагаки

N

,

Shinomura

T

,

000

000

000

000 Shinomura

000

2005

)

Подавление активатора цветков Hd3a является основной причиной эффекта ночного перерыва в рисе

.

Растительная ячейка

17

:

3326

3336

Koo

BH

,

Yoo

SC

,

Park

JW

,

Kwon

CT

,

Lee

BD

,

An

G

Li

J

,

Li

Z

,

Paek

NC

(

2013

)

Естественная вариация в OsPRR37 регулирует дату заголовка и способствует выращиванию риса в широком диапазоне широт

.

Завод Мол

6

:

1877

1888

Krzymuski

M

,

Andrés

F

,

Cagnola

JI

,

Jang

S

,

Yanovsky

MJ

,

Coupland

2015

)

Динамика выражения FLOWERING LOCUS T кодирует информацию длинного дня

.

Завод J

83

:

952

961

Leivar

P

,

Monte

E

(

2014

)

PIFs: Системные интеграторы в разработке заводов

.

Растительная ячейка

26

:

56

78

Li

C

,

Lin

H

,

Dubcovsky

J

(

2015

)

Факторные комбинации белковых взаимодействий генерируют множество комплексов активации флоригенов в пшенице и ячмене

.

Завод J

84

:

70

82

Lumsden

PJ

,

Furuya

M

(

1986

)

Свидетельства о двух действиях света в фотопериодической индукции цветения у Pharbitis nil.

Физиология растительных клеток

27

:

1541

1551

Lv

B

,

Нитчер

R

,

Han

X

,

Wang

S

,

Ni

F

,

Li

K

,

Wu

J

,

Dubcovsky

J

,

Fu

D

(

2014

)

Характеристика гена FLOWERING LOCUS T1 ( FT1 ) у пшеницы Brachypodium и Brachypodium.

PLoS One

9

:

e

Monte

E

,

Alonso

JM

,

Ecker

JR

,

Zhang

Y

,

Li

X

,

Young

J Austips

Austips

,

Перепел

PH

(

2003

)

Выделение и характеристика мутантов phyC у Arabidopsis выявляют сложные перекрестные помехи между сигнальными путями фитохромов

.

Растительная ячейка

15

:

1962

1980

Мерфи

RL

,

Klein

RR

,

Morishige

DT

,

Brady

JA

,

Руни

WL

,

Miller

000 FR

Klein

PE

,

Mullet

JE

(

2011

)

Совпадающее световое и часовое регулирование белка-регулятора псевдореклика 37 ( PRR37 ) контролирует фотопериодическое цветение сорго

.

Proc Natl Acad Sci USA

108

:

16469

16474

Нагатани

A

(

2004

)

Светорегулируемая ядерная локализация фитохромов

.

Curr Opin Plant Biol

7

:

708

711

Нисида

H

,

Ishihara

D

,

Ishii

M

,

Kaneko

T

,

Kawahigashi

H

,

9000

000 Dasi Tanaka

K

,

Handa

H

,

Takeda

K

и др.(

2013

)

Фитохром C — ключевой фактор, контролирующий цветение длинного дня ячменя

.

Plant Physiol

163

:

804

814

Park

E

,

Kim

J

,

Lee

Y

,

Shin

J

,

Oh

E

,

Chung

WI

0004 WI

,

0004 Чой

G

(

2004

)

Деградация фактора 3, взаимодействующего с фитохромом, в опосредованной фитохромом световой сигнализации

.

Физиология растительных клеток

45

:

968

975

Pearce

S

,

Kippes

N

,

Chen

A

,

Debernardi

JM

,

Dubcovsky

J

(

, исследования пшеницы с использованием ROC5

и PHYTOCHROME C Мутанты обнаруживают общие и специфические функции в регуляции цветения и путей избегания тени

.

БМК Завод Биол

16

:

141

Pearce

S

,

Vanzetti

LS

,

Dubcovsky

J

(

2013

)

Экзогенные гиббереллины вызывают развитие колосьев пшеницы в короткие дни только в присутствии

VERNALIZATION.

Plant Physiol

163

:

1433

1445

Périlleux

C

,

Bernier

G

,

Kinet

JM

(

1994

)

Циркадные ритмы и индукция цветения у длиннодневных трав Lolium temulentum.

Среда растительных клеток

17

:

755

761

Pittendrigh

CS

,

Minis

DH

(

1964

)

Увлечение светом циркадных колебаний и их роль в качестве фотопериодических часов

.

Am Nat

98

:

261

294

Rockwell

NC

,

Su

YS

,

Lagarias

JC

(

2006

)

Фитохромная структура и сигнальные механизмы

.

Annu Rev Plant Biol

57

:

837

858

Shaw

LM

,

Turner

AS

,

Herry

L

,

Griffiths

S

,

Laurie

DA

(

из 1 9018

) пшеница ( Triticum aestivum L.), которая придает фенотип позднего цветения в течение длинных дней

.

PLoS One

8

:

e79459

Shaw

LM

,

Turner

AS

,

Laurie

DA

(

2012

)

Влияние нечувствительности к фотопериоду Ppd-1a мутаций на пути фотопериода пшеницы через три гексаплоидных пути Triticum aestivum )

.

Завод J

71

:

71

84

Shen

Y

,

Khanna

R

,

Carle

CM

,

Quail

PH

(

2007

)

Фитохром вызывает быструю реакцию фосфорилирования

и деградации красного света PIF5.

Plant Physiol

145

:

1043

1051

Shen

H

,

Zhu

L

,

Castillon

A

,

Majee

M

,

Downie

B

,

Huq

(2008)

Light индуцированное фосфорилирование и деградация негативного регулятора PHYTOCHROME-INTERACTING FACTOR1 из Arabidopsis зависят от его прямых физических взаимодействий с фотоактивированными фитохромами

.

Plant Cell

20

:

1586

1602

Suárez-López

P

,

Wheatley

K

,

Robson

F

,

Onouchi

H

,

Valverde

F

,

000

0005

0005

CONSTANS является посредником между циркадными часами и контролем цветения у Arabidopsis.

Природа

410

:

1116

1120

Такано

M

,

Инагаки

N

,

Xie

X

,

Yuzurihara

N

,

Hihara

F

,

000

000

000 Yhizuka 9000 4 Нисимура

M

,

Miyao

A

,

Hirochika

H

и др.(

2005

)

Отличительные и совместные функции фитохромов A, B и C в борьбе с деэтиоляцией и цветением риса

.

Заводская ячейка

17

:

3311

3325

Taoka

K

,

Ohki

I

,

Tsuji

H

,

Furuita

K

,

Hayashi

K

,

Yanase

000

000 Yanase

000

000 Yanase

000

000 Накашима

C

,

Purwestri

YA

,

Tamaki

S

и др.(

2011

)

Белки 14-3-3 действуют как внутриклеточные рецепторы для риса Hd3a florigen

.

Природа

476

:

332

335

Thomas

B

,

Vince-Prue

D

(

1997

)

Фотопериодизм в растениях

, Ed 2.

Academic Press

,

London

Tiwari

SB

,

Shen

Y

,

Chang

HC

,

Hou

Y

,

Harris

A

,

Ma

SF

,

Mc50004

Mc50004,

Hymus

GJ

,

Adam

L

,

Marion

C

и др.(

2010

)

Регулятор времени цветения CONSTANS подключается к промотору FLOWERING LOCUS T через уникальный cis -элемент

.

Новый Фитол

187

:

57

66

Тернер

A

,

Beales

J

,

Faure

S

,

Dunford

RP

,

Laurie

DA

(

2005

pudse18002-регулятор давления)

обеспечивает адаптацию к световому периоду у ячменя

.

Наука

310

:

1031

1034

Valverde

F

,

Mouradov

A

,

Soppe

W

,

Ravenscroft

D

,

Samach

A

0005000

9000recept5000

белка КОНСТАНС в фотопериодическом цветении

.

Наука

303

:

1003

1006

Парик

PA

,

Kim

MC

,

Jaeger

KE

,

Busch

W

,

Schmid

M

,

Lohmann

000

000

J

2005

)

Интеграция пространственной и временной информации во время индукции цветков у Arabidopsis.

Наука

309

:

1056

1059

Wilhelm

EP

,

Turner

AS

,

Laurie

DA

(

2009

)

Нечувствительность к фотопериоду Ppd-A1a мутации в тетраплоидной пшенице ( Desfurum.

Theor Appl Genet

118

:

285

294

Woods

DP

,

Ream

TS

,

Minevich

G

,

Hobert

O

,

Amasino

RM

(

PHYTODE для анриодного светоприемника)

цветение в траве умеренного климата, Brachypodium distachyon.

Генетика

198

:

397

408

Ян

L

,

Loukoianov

A

,

Blechl

A

,

Tranquilli

G

,

Ramakrishna

W

000

000

SanMiguel Echenique

V

,

Dubcovsky

J

(

2004

)

Ген пшеницы VRN2 представляет собой репрессор цветения, подавляемый яровизацией

.

Наука

303

:

1640

1644

Ян

S

,

Weers

BD

,

Morishige

DT

,

Кефаль

JE

(

2014

)

CONSTANS — активатор цветения сорго

с регулируемым световым периодом.

БМК Завод Биол

14

:

148

Заметки автора

© 2017 Американское общество биологов растений.Все права защищены.

© Автор (ы) 2017. Опубликовано Oxford University Press от имени Американского общества биологов растений. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/), которая разрешает неограниченное повторное использование, распространение и воспроизведение на любом носителе при условии, что оригинальная работа правильно процитировано.

Повышенный уровень сахара в крови по утрам: причины и профилактика

Что вызывает повышенный уровень сахара в крови по утрам?

Обычно известные причины, по которым у вас может быть высокий уровень сахара в крови по утрам, включают перекусы перед сном с высоким содержанием углеводов и недостаток лекарств от диабета.

Тем не менее, две менее известные причины могут вызывать утренние проблемы с уровнем сахара в крови: феномен рассвета и эффект Сомоги. Эти причины высокого уровня сахара в крови по утрам являются результатом изменений в организме и реакций, которые происходят во время сна.

Что такое явление рассвета?

Ваше тело использует глюкозу (сахар) для получения энергии, и важно иметь достаточно дополнительной энергии, чтобы просыпаться по утрам. Таким образом, в течение некоторого периода времени ранним утром, обычно между 3 часами утра.м. и в 8 часов утра ваше тело начинает вырабатывать запасенную глюкозу, чтобы подготовиться к предстоящему дню.

В то же время ваше тело выделяет гормоны, снижающие чувствительность к инсулину. Кроме того, эти события могут происходить, когда ваши дозы лекарства от диабета, принятые накануне, заканчиваются.

Эти события вызывают повышение уровня сахара в крови утром («на рассвете»).

Что такое эффект Сомоги?

Вторая возможная причина повышенного уровня сахара в крови по утрам — это эффект Сомоджи, который иногда также называют рикошетной гипергликемией.Он был назван в честь доктора, который первым о нем написал.

Если ваш уровень сахара в крови падает слишком низко посреди ночи, когда вы спите, ваше тело будет выделять гормоны в попытке «спасти» вас от опасно низкого уровня сахара в крови. Гормоны делают это, побуждая вашу печень выделять хранящуюся глюкозу в больших количествах, чем обычно. Но эта система не идеальна для человека с диабетом, поэтому печень выделяет больше сахара, чем необходимо, что приводит к высокому уровню сахара в крови по утрам.Это эффект Сомоджи.

Как определяется, является ли явление рассвета или эффект Сомоги причиной высокого уровня сахара в крови?

Ваш врач, скорее всего, попросит вас проверять уровень сахара в крови с 2 до 3 часов ночи несколько ночей подряд. Если в течение этого времени уровень сахара в крови постоянно низкий, можно предположить эффект Сомоджи. Если в течение этого периода уровень сахара в крови в норме, причиной, скорее всего, является явление рассвета.

Некоторые дополнительные ключи к разгадке того, что эффект Сомоги может быть причиной, включают кошмары, беспокойный сон и ночное потоотделение, поскольку все это признаки низкого уровня сахара в крови.

Как контролировать высокий уровень сахара в крови по утрам?

После того, как вы и ваш врач определите, как у вас уровень сахара в крови ночью, он или она может посоветовать вам изменения, которые вам необходимо внести, чтобы лучше контролировать их. Варианты, которые может обсудить ваш врач, зависят от причины повышения уровня сахара в крови по утрам.

Для явления рассвета:

  • Изменение времени приема или типа лекарств от диабета
  • Есть более легкий завтрак
  • Повышение утренней дозы лекарства от диабета
  • Если вы принимаете инсулин, переключитесь на инсулиновую помпу и запрограммируйте ее на выпуск дополнительного инсулина утром

Для эффекта Somogyi:

  • Снижение дозы лекарств от диабета, вызывающих ночные минимумы
  • Добавление углеводов перед сном
  • Делал вечернюю зарядку раньше
  • Если вы принимаете инсулин, переключитесь на инсулиновую помпу и запрограммируйте ее на высвобождение меньшего количества инсулина за ночь

Связанная страница | Ротари Клуб Рокавей

23.05.2013
Среда, 22 мая, и ознаменовали официальное завершение сезона Ротари Боулинг-лиги 2012-13 гг.Наша команда отлично финишировала, победив команду из Ливингстона, занявшую 2 -е место, и заработала все 7 очков за сессию. У Терри и ПП Стив была чистая вторая игра, а ПП Стив опубликовал две 200 игр, что было «веселым» вечером. П.П. Шейла была там даже, чтобы подстегнуть нас и быть под рукой на ежегодной фотографии команды. Rockaway завершил успешный сезон на 3 месте.

17.05.2013
ОФИЦИАЛЬНО !! Осталась только одна ночь для игры в боулинг. Rockaway завершит сезон на 3 -м месте в Ротари-лиге в этом году, уступив Ливингстону на 2-м -м и чемпиону лиги этого года Денвиллу BZZZ.В среду, 15 мая th , Rockaway выбил команду из Ливингстона и заработал 3 из 7 возможных очков за ночь. Нашей высокой игрой был Стив ПП с 204.

10.05.2013
В среду, 8 мая -го , Rockaway выбил 3-е место из команды Парсиппани, набрав 5 из 7 возможных очков за сессию. У нас было несколько «звездных» фреймов, и ПП Джордж провел свою первую чистую игру в этом году с 202. Поскольку в сезоне осталось всего две ночи, Denville BZZZZ не может быть пойман и закрыл чемпионат лиги в этом году.У них отрыв в 15 очков, а в финальных сессиях доступно только 14 очков. Поздравляю, Денвилл!

5/4/2013

За три недели до конца сезона все команды высшей лиги защищали свои позиции, взяв все семь очков за сессию в среду, 1 мая. В текущем рейтинге Денвилл Бзззз занимает 1-е место на 20 очков, Ливингстон — на 2-м, опережая наших боулеров Rockaway на 20 очков. Команда, занявшая 4-е место, отстает от нас всего на 15 очков, а команда, занявшая 5-е место, отстает на 19.Это, безусловно, будет непростой задачей, ведь в сезоне осталось всего 21 очко. Rockaway поставил 5-е место среди «Бернард Банкирс». Все в обеих командах показали результаты ниже наших средних; однако мы были лишь немного ближе к нашим средним показателям, чем наши оппоненты.

26.04.2013
В среду, 24 апреля -го -го, Rockaway выбил команду Парсиппани, выиграв 5 из 7 возможных очков в матче. У нашей команды было несколько «звездных» фреймов, и двое участников сыграли в среднем за сезон, а PP Sheila набирала в среднем 12 очков за ночь.Наша лучшая игра была объявлена ​​PP Geo с 202. С 4 неделями до конца сезона наша команда Rockaway надеется сохранить свое нынешнее 3 -е место в турнирной таблице, уступая Ливингстону в 2 и и BZZZZ в 1-м месте. ул. .

18.04.2013
В прошлую среду, 17 апреля -го -го, Рокавей обыграл команду Джефферсона (Клуб Маргит) с Мэри Берри, замененной на «другой стороне» и показавшей выше среднего уровня !! Наши боулеры заработали 5 из 7 очков за сессию, где все, кроме ПП Джорджа, выиграли по средним показателям за сезон, а ПП Стив лидировал с двумя 200 играми.Rockaway остается на 3 -м месте после Ливингстона и 1-го -го -го места в Денвилле BZZZZ.

11.04.2013
В среду, 10 апреля -го -го, наши боулеры Rockaway соревновались против 1 -го -го места «Denville BZZZZ» и заработали 4 из 7 очков за сессию. У Rockaway было несколько «звездных» фреймов, а у PP Steve был хороший матч с двумя 200 играми (204 и 210). Джон Сандерс из Денвилла имел 263 балла в игре, выигранной Денвиллом; его максимум за год.Приближается конец сезона, и Рокавей борется с командой Парсиппани (Schlitt Happens) за 3 -е место после Ливингстона (на данный момент 2-е) и 1-е место — Денвилл.

8 апреля 2103
Среда, 3 апреля, была описана П.П. Джорджем как «спокойная ночь общения» для наших боулеров из Рокавей. Хотя члены нашей команды наслаждались совместным вечером, они проиграли все 7 очков команде из Ливингстона, занявшей 2-е место, проиграв дерево с колоссальными 322 очками. Даже защищающиеся чемпионы могут хорошо провести ночь.

28.03.2013
В среду, 27 марта -го -го, Rockaway обыграл «Бернардов Банкиров». Первые две игры были очень близки, и наши боулеры Rockaway выиграли обе с небольшим отрывом. В третьей игре «Бернардс» выиграли с результатом 99 кеглей, составив финальный счет сессии — Rockaway (4), Bernards Bankers (3). У PP George была высокая игра для Rockaway с 203. Боб Кариелло выбил 210, чтобы ускорить победу Бернардов в финальной игре.

21.03.2013
В среду вечером, 20 марта -го -го, Rockaway выбил боулинг из команды Джефферсона, «Margit’s Club».Это была захватывающая сессия, когда на соседней дорожке с нашей Ротари-лигой была проведена идеальная игра «300». Наши котелки ушли с 5 очками за ночь с деревянным выигрышем с наименьшим преимуществом в одну кеглю. Все члены нашей команды превзошли свои средние показатели за ночь… с 5 до 11 очков. Сейчас Rockaway прочно занимает 3-е место в турнирной таблице. Занявшая второе место команда Ливингстона теперь всего на 2 очка отстает от Денвилла, занявшего второе место.

14.03.2013
В среду вечером, 13 марта -го , Rockaway сыграл в боулинг против «Schlitt Happens» из Парсиппани.Наша команда провела успешную сессию, набрав 5 из 7 возможных очков. Лучшими играми для Rockaway были PP Steve с 213 и PP George с 212. Джордж опубликовал свой самый высокий результат за несколько лет с 577. Терри Фелтс выиграла 515 серий, что переведет ее в категорию элиты … » Серия High Scratch — Женщины ». Наша команда провела одну «чистую игру» и переместилась на 3-е место в турнирной таблице лиги, уступив 2 и месту команде Ливингстона и лидеру лиги Денвиллу BZZZZ.

07.03.2013
Вечером в прошлую среду, 6 марта -го , Rockaway выбил команду из Ливингстона.Хотя у нас было всего три боулера против полного состава Ливингстона, Rockaway заработал 5 из 7 возможных очков за сессию. Лучшая игра для Rockaway была объявлена ​​PP Стивом с результатом 201. У нашей команды было несколько индюков, довольно много «звездных фреймов», и все играли в боулинг выше своих средних показателей. В настоящее время Rockaway делит 3 -е место с командой Parsippany, позади Ливингстона на 2-м -м и Denville BZZZZ на 1-м -м месте.

28.02.2013

В минувшую среду вечером Rockaway выбил команду из Парсиппани.Наши боулеры заработали 3 из 7 возможных очков за сессию. Только двое из четырех членов нашей команды превзошли свои средние показатели за ночь. Высокая игра была опубликована PP Стивом с 214, и PP Джордж НЕ будет упоминать, кто выбил низкую игру или счет !. По итогам вечера Rockaway находится на четвертом месте в турнирной таблице.

21.02.2013

В среду вечером, 20 февраля -го , Rockaway выбил первую команду из Денвилла. Наши боулеры смогли выиграть первую игру с минимальным отрывом — 1 кеглем.Вторую и третью партии вечера взял Денвилл. Окончательный результат сессии был: Денвилл — 5, Рокавей — 2. Наши лучшие партии были ПП Джордж с 233 и ПП Стив с 200.

14.02.2013
В среду вечером, 13 февраля -го , наша команда Rockaway сыграла в боулинг с командой Парсиппани «Schlitt Happens» (названной в честь их нынешнего президента Джона Шлитта). Каждая игра в матче была очень близка, но Rockaway удалось увеличить наш годовой результат на 7 очков.Лучшей игрой в этот вечер был PP Steve с 202, и он также играл выше среднего в каждой игре. Престижность, Стив!

07.02.2013
Проиграв 17 игр подряд в январе, Rockaway вернулся вчера вечером с хорошим результатом против Bernardsville Bankers. Боб Кариелло из Бернардсвилля показал вторую по величине скретч-серию в Ротари-лиге в этом году с результатом 697. Все три игры были очень близки; Тем не менее, Rockaway выиграл все 7 очков за долгожданное изменение. За исключением П.П. Джорджа, все участники команды оказались выше среднего.ПП Шейла была нашей звездой с 24 кеглем ВЫШЕ среднего в каждой игре за ночь. Высокая игра была ПП Стив с 202.

14.01.2013
В среду, 9 января -го , Rockaway провёл матч-реванш с «Бернард Банкирс», и, как и предполагалось, они были «жаждут крови». Члены нашей команды играли в боулинг на уровне или выше наших средних показателей. PP Стив набрал 212 очков; однако мы получили только 2 из 7 возможных очков. Ведущий Bernards, Боб Кариелло, ушел с вечера со средним результатом 215 сессий!

07.01.2013
В среду, 2 января, и , Rockaway выиграл 3 -е место Bernardsville Bankers и заработал 5 из 7 возможных очков за вечер.У нас был «звездный фрейм» как раз тогда, когда он нам понадобился, чтобы сплотить его в финальной игре. Лучшая игра для нашей команды была объявлена ​​ПП Стивом с результатом 205. Rockaway планирует снова сыграть с «Банкирами» на следующей неделе, так что они, возможно, хотят отомстить!

31.12.2012
Из-за метели на следующий день после Рождества в боулинг вышли всего 4 команды. Из-за проблем с дорожным движением половина нашей команды смогла стартовать раньше, чем через полчаса после запланированного времени старта. Мы должны были сыграть против команды Джефферсона, которая «не выступала».Нам придется подождать, пока они определят фактический исход матча, пока они не определятся с сессией; тем не менее, члены нашей команды показали свои средние показатели за ночь, и обычно Джефферсон и Рокавей разделяют лишь один или два гандикапа.

24.12.2012
В среду, 20 декабря -го , Rockaway встретился с командой из Парсиппани. Только один из 8 боулеров в этом матче смог набрать средний балл по всем трем играм; к сожалению, этот котелок был из Парсиппани.Может быть, все мы были взволнованы Рождеством. Лучший результат от Rockaway был у PP Sheila в последней игре, на 35 очков больше среднего (174). Rockaway выиграл игру, и окончательный результат был Parsippany (5) и Rockaway (2).

17.12.2012
В прошлую среду вечером, Rockaway выиграл у нынешней команды Ливингстона, занявшей первое место, уступив ПП Шейлу ПП Стива. Rockaway смог выиграть очень близкую первую игру со счетом 29 очков. Во второй игре ведущий Ливингстона Боб Фейд нанес семь ударов подряд, что в сумме составило 249.Наша команда Rockaway медленно теряла позиции по ходу игры. В последнем фрейме PP Sheila встретился лицом к лицу с Бобом Фейдом, которому нужно было нанести удар, чтобы выиграть игру для своей команды. Как настоящий кусачий гвоздь, PP Sheila накатила запасной своими первыми двумя мячами и обеспечила победу Rockaway своим последним мячом в игре. Престижность PP Sheila за выход в Rockaway для победы. Наши боулеры внесли импульс в финальную игру, которая на протяжении всей сессии выиграла все семь очков.

10.12.2012
Вечером в прошлую среду, 5 декабря -го -го, наша команда Rockaway обыграла команду Denville B. После первой игры вечера некоторые боулеры (громко) пожаловались на то, что одна из дорожек слишком сухая. После того, как Rockaway выиграл первую игру с более чем 100 кеглями, дорожка была заново смазана. Команда Denville вернулась, чтобы выиграть вторую игру, но Rockaway упорно продолжал выигрывать в финальной игре и набирать все карты.

03.12.2012

В прошлую среду вечером наши боулеры Rockaway соревновались с командой PDG Maurie из Парсиппани, «Schlitt Happens», названной в честь нынешнего президента клуба Джона Шлитта.Перед матчем две команды разделили 7 -е место в турнирной таблице лиги. Rockaway прочно закрепился на 7 -м месте, уступив 5 из 7 возможных очков за сессию команде Парсиппани, которая переместилась на 6-е -е место.

26.11.2012

В канун Дня благодарения Rockaway проиграл 2 и место «Bernards Bankers». Вся наша команда приложила презентабельные усилия с парой «звездных фреймов», и участники почти опубликовали две чистые игры.В захватывающей финальной игре Rockaway выиграл наши единственные очки за вечер с помощью «4 bagger» ПП Стива в заключительных кадрах игры. Rockaway выиграл игру с небольшим отрывом в 2 кегли, несмотря на то, что один из боулеров Бернарда показал свою высокую игру (237) за год. Поздравляем Майка Делгато с его серией 655!

19.11.2012
В среду, 14 ноября -го , Rockaway выбил Джефферсона (Клуб Маргит), матч, который первоначально был назначен на Хэллоуин; тем не менее, у нас был визит от Сэнди и так….. две недели спустя …… сезон возобновился. Высокий уровень игры Rockaway на вечер был объявлен PP Стивом Барчем со счетом 214. Все члены нашей команды показали, по крайней мере, свой средний результат во всех трех играх, но нам удалось выиграть только одну игру. Несколько индеек; Однако окончательный результат вечера был Джефферсон — 5 баллов, Рокавей — 2 балла.

29.10.2012

В минувшую среду вечером Rockaway обыграл «Бернардов Банкиров». Наша команда показала хорошие результаты; Тем не менее, Bernard’s провел три матча по 200 и набрал 5 из 7 очков.Благодаря своей победе боулеры Бернарда опережают Рокавей в «середине турнирной таблицы» лиги. Достойно упоминания — в Ротари-лиге 11 боулеров … только у трех из них в этом году сыграно 200 игр, и наша собственная ПП Шейла входит в эту избранную группу.

22.10.2012

В прошлую среду была отмечена седьмая неделя сезона боулинга в Ротари, когда Рокавей встретился с командой Денвилла «Б». Денвилл отыграл только 200 игр в этой сессии и выиграл 5 из 7 возможных очков за вечер.По итогам сезона Ливингстон прочно занимает первое место. Все оставшиеся команды близки с текущим турнирным положением, которое будет определено после завершения грим.

10.10.2012 — Rockaway обыграл команду из Ливингстона, занимающую 1 -е место, и выиграл 2 из 3 игр, набрав 4 очка за вечер. Кульминацией сессии стал Боб Фейд, набравший идеальные 300 очков в финальной игре. Поздравляю Боба !! Также спасибо Мэри Берри, которая обыграла своего супруга в последней игре.

10/3/2012 — С заменой Мэри Берри на Шейлу, Rockaway выиграл 5 из 7 очков за сессию у «Бернардс Банкирс».

26.09.2012 — Rockaway боулинг «Клуб Маргит» из Джефферсона. После серьезного поражения в первой игре Rockaway восстановился и выиграл вторую и третью игры. Финальная игра включает в себя две игры с более чем 200 играми за Rockaway, при этом третий член команды играет в боулинг на 11 кеглей больше среднего.

24.09.2012

В прошлую среду вечером участники соревнований Rockaway, команда PDG Мори Мадера по Парсиппани, запросили «грим», так как члены их команды были разбросаны по США и Европе и не могли получить достаточное количество замен, чтобы покрыть их.Rockaway сыграл в боулинг, и ему придется подождать, чтобы узнать исход матча. Наши боулеры все еще устанавливают средние значения, но в этой сессии следует отметить два игрока: PP Стив Барч с 189 и PP Sheila с 181, включая «Индейку».

17.09.2012

На прошлой неделе наши боулеры Rockaway продемонстрировали некоторую ржавчину в начале сезона и набрали все 7 очков командой из Ливингстона. Только два члена нашей команды смогли выиграть на одну игру больше своих средних значений за сессию.По словам П.П. Джорджа, «Мы все еще пытаемся вспомнить, в какую сторону летит мяч… Он далеко от нас, к кеглям?» Однако пицца оказалась хорошей!

10.09.2012

Это снова то время года, и действующие чемпионы лиги Rockaway Bowlers начали сезон в прошлую среду, 5 сентября. против команды Denville «B». ПП Шейла отлично начала вечер со своей первой в истории 200-й игрой. Благодаря хорошему результату всей команды, Rockaway ушел со всеми 7 очками за вечер.Всем, кто заинтересован в замене в течение сезона, обращайтесь к Джорджу по адресу [email protected]

Общественность нуждается в подготовке к побочным эффектам вакцины

Отчет Science о COVID-19 поддерживается Пулитцеровским центром и Фондом Хейзинг-Саймонса

Этим летом вычислительный биолог Люк Хатчисон вызвался для испытания COVID-19 Модерны. вакцина. Но после второй инъекции его рука распухла до размера «гусиное яйцо», — говорит Хатчисон.Он не может быть уверен, что получил вакцину, а не плацебо, но в течение нескольких часов Хатчисон, который был здоров, ему было 43 года, у него начались боли в костях и мышцах и поднялась температура 38,9 ° C. «Меня трясло. У меня были холодные и горячие приливы », — говорит он. «Я всю ночь сидел у телефона и думал:« Может, мне позвонить в службу 911? »»

Симптомы Хатчисона исчезли через 12 часов. Но, по его словам, «меня никто не готовил к этой серьезности».

Он говорит, что общественность должна быть лучше подготовлена, чем он, потому что часть людей может столкнуться с интенсивными, хотя и преходящими, побочными эффектами вакцины Moderna, называемыми реактогенностью.Некоторые эксперты в области здравоохранения согласны с этим.

«Кому-то нужно обратиться к слону: как насчет реактогенности вакцины? Хотя это… не вызовет каких-либо долгосрочных проблем… как это восприятие пойдет на пользу публике, когда они начнут его получать? » — спрашивает Дебора Фуллер, вакцинолог из Вашингтонского университета в Сиэтле, чья лаборатория разрабатывает РНК-вакцины второго поколения против COVID-19. Она опасается, что побочные эффекты могут усилить нерешительность в отношении вакцины. «Я чувствую, что это замалчивается.

Эти опасения возникают после недели хороших новостей о вакцинах против коронавируса: и Moderna, и Pfizer вместе с BioNTech объявили, что их вакцины с информационной РНК (мРНК) достигли 95% эффективности в клинических испытаниях с участием десятков тысяч людей. Фирмы добавили, что испытания не выявили серьезных проблем с безопасностью.

Обе вакцины состоят из фрагмента генетического кода, управляющего производством шипового белка коронавируса, который доставляется в крошечный жировой пузырек, называемый липидной наночастицей. Некоторые исследователи подозревают, что реакция иммунной системы на это средство доставки вызывает краткосрочные побочные эффекты.

Эти временные реакции не должны отговаривать людей от вакцинации перед лицом пандемического вируса, который убивает по крайней мере одного из 200 зараженных им вирусов, — говорит Флориан Краммер, вакцинолог из Медицинской школы Икана на горе Синай, который участвовал в Суд над Pfizer. Боль в руках, жар и усталость «неприятны, но не опасны», — говорит он. Меня совсем не беспокоит [реактогенность] ».

Большинство людей избегают «серьезных» побочных эффектов, определяемых как те, которые мешают повседневной активности.Менее чем у 2% реципиентов вакцин Pfizer и Moderna развилась сильная лихорадка от 39 ° C до 40 ° C. Но если компании получат разрешения регулирующих органов, они планируют поставить вакцину 35 миллионам человек по всему миру к концу декабря. Если бы 2% испытали сильную лихорадку, это было бы 700 000 человек.

ГРАФИКА: V. ALTOUNIAN / SCIENCE

Другие временные побочные эффекты, вероятно, затронут еще большее количество людей. Независимая комиссия, проводившая промежуточный анализ огромного исследования Moderna, обнаружила, что у 9 серьезных побочных эффектов была утомляемость.7% участников, боль в мышцах у 8,9%, боль в суставах у 5,2% и головная боль у 4,5%. В испытании вакцины Pfizer / BioNTech цифры были ниже: серьезные побочные эффекты включали усталость (3,8%) и головную боль (2%).

Но это более высокий уровень серьезных реакций, чем люди могут привыкнуть. «Это более высокая реактогенность, чем обычно наблюдается у большинства вакцин против гриппа, даже у высокодозных», — говорит Арнольд Монто, эпидемиолог из Школы общественного здравоохранения Мичиганского университета.

Таким образом, передовые работники общественного здравоохранения должны будут «иметь историю, которая выходит перед [историями, подобными рассказу Хатчисона] — которая отвечает тому способу, которым люди будут пытаться превратить эту историю в историю о вреде, нанесенном вакциной», — говорит Бернис Хаусман, эксперт по спорам о вакцинах Медицинского колледжа Государственного университета Пенсильвании.

Прозрачность — ключ к успеху, подчеркивает Хаусман. Например, вместо того, чтобы сводить к минимуму вероятность повышения температуры тела, администраторы вакцины могут предупреждать людей о том, что у них может возникнуть высокая температура, которая может казаться сильной, но носит временный характер. «Это в значительной степени поможет людям почувствовать, что им говорят правду». Дрю Вайсман, иммунолог из Пенсильванского университета, чье исследование способствовало созданию обеих вакцин, добавляет: «Компании просто должны предупредить людей:« Это то, чего вы должны ожидать.Прими тайленол и выпей его в течение дня ».

Хаусман также видит необходимость в поддержке людей, у которых есть серьезные реакции. Например, людям может понадобиться «горячая линия», на которой медсестра проводит сортировку… чтобы выяснить, нужно ли вам ехать в больницу или нет. Покроются ли ваши медицинские расходы, если вы это сделаете? Это важные вопросы ».

Вакцины Moderna и Pfizer / BioNTech требуют введения двух доз, разделенных несколькими неделями. По словам Вайсмана, реактогенность обычно выше после второй дозы.Побочные эффекты «означают, что вакцина работает хорошо. … [Это] означает, что у вас был такой хороший иммунный ответ на первую дозу, и теперь вы видите последствия этого », — говорит он.

«Мы подозреваем, что липидные наночастицы вызывают реактогенность, потому что липидные наночастицы без мРНК в них делают то же самое у животных», — говорит Вайсман. «Мы видим производство в мышцах медиаторов воспаления, которые вызывают боль, [покраснение], отек, лихорадку, симптомы гриппа и т. Д.»

Хатчисон надеется, что скоро появятся новые вакцины.Тем не менее, он говорит: «Учитывая, что COVID может убивать или выводить из строя людей, всем следует укусить пулю и ожидать тяжелой ночи. … Возьми побольше напроксена ».

Как лучше спать — Тональный крем для сна

Хорошо известно, что сон необходим для нашего физического и психического здоровья. Но, несмотря на его важность, тревожный процент людей постоянно лишен качественного сна и особенно сонлив в течение дня.

Хотя существует широкий спектр причин и типов проблем со сном, экспертный консенсус указывает на несколько конкретных шагов, которые способствуют более спокойному сну.Такие организации, как CDC, Национальный институт здоровья, Национальный институт старения и Американская академия семейных врачей, указывают на одни и те же фундаментальные советы по улучшению отдыха.

Для многих попытка реализовать все эти стратегии может оказаться непосильной задачей. Но помните, что это не все или ничего; вы можете начать с небольших изменений и постепенно переходить к более здоровым привычкам сна, также известным как гигиена сна.

Чтобы сделать эти улучшения гигиены сна более доступными, мы разделили их на четыре категории:

  • Создание спальни, вызывающей сон
  • Оптимизация графика сна
  • Создание режима перед сном
  • Формирование привычек, способствующих засыпанию в течение дня

В каждой категории вы можете найти определенные действия, которые помогут вам засыпать, спать дольше и просыпаться отдохнувшими.

Создание спальни, вызывающей сон

Важный совет, который поможет быстро и легко заснуть, — сделать спальню местом комфорта и расслабления. Хотя это может показаться очевидным, на это часто не обращают внимания, что затрудняет засыпание и засыпание по ночам.

Создавая среду для сна, сосредоточьтесь на максимальном комфорте и сведении к минимуму отвлекающих факторов, в том числе с помощью следующих советов:

  • Используйте высококачественный матрас и подушку: Качественный матрас жизненно необходим для того, чтобы вы чувствовали себя достаточно комфортно, чтобы расслабиться.Вместе с подушкой он также гарантирует, что ваш позвоночник получит надлежащую поддержку, чтобы избежать болей и болей.
  • Выберите качественное постельное белье: Простыни и одеяла играют важную роль в том, чтобы ваша кровать выглядела привлекательной. Выбирайте удобные на ощупь постельные принадлежности, которые помогут поддерживать комфортную температуру в течение ночи.
  • Избегайте перебоев со светом: Избыточное воздействие света может нарушить ваш сон и циркадный ритм. Затемняющие шторы на окнах или маска для сна для глаз могут блокировать свет и мешать ему отдыхать.
  • Cultivate Peace and Quiet: Сведение к минимуму шума — важная часть создания спальни, благоприятной для сна. Если вы не можете устранить близлежащие источники шума, попробуйте заглушить их с помощью вентилятора или аппарата белого шума. Беруши или наушники — еще один вариант, чтобы абразивные звуки не беспокоили вас, когда вы хотите спать.
  • Найдите приемлемую температуру: Вы не хотите, чтобы температура в спальне отвлекала от слишком жаркой или слишком холодной температуры.Идеальная температура может варьироваться в зависимости от человека, но большинство исследований поддерживает сон в более прохладной комнате, температура которой составляет около 65 градусов.
  • Введите приятные ароматы: Легкий успокаивающий аромат может помочь вам заснуть. Эфирные масла с натуральными ароматами, например, лаванды, могут придать вашей спальне успокаивающий и свежий запах.

Оптимизация графика сна

Контроль над своим ежедневным режимом сна — мощный шаг на пути к лучшему сну.Чтобы начать использовать свой график в ваших интересах, попробуйте реализовать эти четыре стратегии:

  • Установите фиксированное время пробуждения: Вашему организму практически невозможно привыкнуть к здоровому режиму сна, если вы постоянно просыпаетесь в разное время. Выберите время для пробуждения и придерживайтесь его, даже в выходные или другие дни, когда в противном случае вам хотелось бы поспать.
  • Бюджет времени для сна: Если вы хотите убедиться, что вы спите рекомендуемое количество сна каждую ночь, вам нужно включить это время в свое расписание.Принимая во внимание ваше фиксированное время пробуждения, работайте в обратном направлении и определите целевое время отхода ко сну. По возможности дайте себе дополнительное время перед сном, чтобы расслабиться и подготовиться ко сну.
  • Будьте осторожны со сном: Чтобы лучше спать по ночам, важно соблюдать осторожность во время сна. Если вы спите слишком долго или слишком поздно, это может нарушить ваш график сна и затруднить засыпание, когда вы этого хотите. Лучшее время для сна — вскоре после обеда, в начале дня, а лучшая продолжительность сна — около 20 минут.
  • Скорректируйте свой график постепенно: Если вам нужно изменить график сна, лучше всего вносить изменения постепенно и с течением времени с максимальной разницей в 1-2 часа за ночь. Это позволяет вашему телу привыкнуть к изменениям, и соблюдение нового расписания будет более устойчивым.

Создание программы перед сном

Если вам трудно заснуть, естественно думать, что проблема начинается, когда вы ложитесь в кровать. В действительности, однако, подготовка ко сну играет решающую роль в вашей подготовке к быстрому и легкому засыпанию.

Плохие привычки перед сном — основная причина бессонницы и других проблем со сном. На изменение этих привычек может потребоваться время, но эти усилия окупятся тем, что вы расслабитесь и будете готовы заснуть, когда пора ложиться спать.

Насколько это возможно, постарайтесь создать постоянный распорядок дня, которому вы будете следовать каждую ночь, потому что это помогает закрепить здоровые привычки и сигнализирует разуму и телу о приближении сна. Включите в этот распорядок следующие три совета:

  • Успокойтесь хотя бы на 30 минут: Гораздо легче спокойно вздремнуть, если вы расслаблены.Тихое чтение, растяжка с малой нагрузкой, прослушивание успокаивающей музыки и упражнения на расслабление — вот примеры того, как прийти в правильное настроение для сна.
  • Приглушите свет: Избегание яркого света может помочь вам перейти ко сну и способствовать выработке организмом мелатонина — гормона, который способствует засыпанию.
  • Отключение от устройств: Планшеты, сотовые телефоны и ноутбуки могут держать ваш мозг в напряжении, что затрудняет полное расслабление. Свет от этих устройств также может подавлять естественное производство мелатонина.По возможности старайтесь отключаться на 30 или более минут перед сном.

Формирование привычек, способствующих засыпанию в течение дня

Сервировка стола для качественного сна — дело всего дня. Несколько шагов, которые вы можете предпринять в течение дня, помогут вам лучше спать ночью.

  • See the Light of Day: Наши внутренние часы регулируются по освещенности. Солнечный свет оказывает сильнейшее влияние, поэтому постарайтесь впитать дневной свет, выйдя на улицу или открыв окна или жалюзи для естественного света.Получение дозы дневного света в начале дня может помочь нормализовать ваш циркадный ритм. Если естественный свет невозможен, вы можете поговорить со своим врачом об использовании светотерапевтического бокса.
  • Найдите время для движения: Ежедневные упражнения имеют множество преимуществ для здоровья, а изменения, которые они вызывают в использовании энергии и температуре тела, могут способствовать крепкому сну. Большинство экспертов не рекомендуют интенсивные упражнения перед сном, поскольку они могут помешать вашему телу успокоиться перед сном.
  • Следите за потреблением кофеина: Напитки с кофеином, включая кофе, чай и газированные напитки, являются одними из самых популярных напитков в мире. Некоторые люди испытывают искушение использовать заряд энергии от кофеина, чтобы попытаться преодолеть дневную сонливость, но такой подход неэффективен и может вызвать длительное недосыпание. Чтобы этого избежать, следите за потреблением кофеина и избегайте его в течение дня, когда он может стать препятствием для засыпания.
  • Будьте внимательны к алкоголю: Алкоголь может вызвать сонливость, поэтому некоторые люди предпочитают пить перед сном.К сожалению, алкоголь влияет на мозг таким образом, что снижает качество сна, и по этой причине лучше избегать употребления алкоголя перед сном.
  • Не ешьте слишком поздно: Может быть труднее заснуть, если ваше тело все еще переваривает плотный обед. Чтобы свести к минимуму нарушения сна из-за еды, старайтесь избегать поздних ужинов и минимизируйте особенно жирную или острую пищу. Если вам нужен вечерний перекус, выберите что-нибудь легкое и полезное.
  • Не курите: Воздействие дыма, включая пассивное курение, было связано с рядом проблем со сном, включая трудности с засыпанием и фрагментарный сон.
  • Зарезервируйте свою кровать только для сна и секса: Если у вас удобная кровать, у вас может возникнуть соблазн болтаться там, выполняя все виды деятельности, но на самом деле это может вызвать проблемы перед сном. Вам нужна прочная мысленная связь между вашей кроватью и сном, поэтому старайтесь ограничивать деятельность в своей постели строго только сном и сексом.

Если не можешь заснуть

Когда вы впервые ложитесь спать или просыпаетесь посреди ночи, вам может быть трудно заснуть.Эти советы помогут объяснить, что делать, если вы не можете спать:

  • Попробуйте техники релаксации: Не сосредотачивайтесь на попытках заснуть; вместо этого сосредоточьтесь на том, чтобы просто расслабиться. Контролируемое дыхание, медитация осознанности, прогрессивная мышечная релаксация и управляемые образы — вот примеры методов релаксации, которые могут помочь вам уснуть.
  • Не туши в постели: Вы хотите, чтобы в вашем сознании не было связи между вашей кроватью и расстройством от бессонницы.Это означает, что если вы провели в постели около 20 минут, но не смогли заснуть, встаньте с постели и займитесь чем-нибудь расслабляющим при слабом освещении. Не проверяйте время в это время. Постарайтесь отвлечься от сна хотя бы на несколько минут, прежде чем вернуться в постель.
  • Эксперимент с разными методами: Проблемы со сном могут быть сложными, и то, что работает для одного человека, может не работать для другого. В результате имеет смысл попробовать разные подходы, чтобы увидеть, что работает для вас.Просто помните, что для вступления в силу новых методов может потребоваться некоторое время, поэтому дайте вашим изменениям время вступить в силу, прежде чем предполагать, что они вам не подходят.
  • Вести дневник сна: Ежедневный дневник сна может помочь вам отслеживать, насколько хорошо вы спите, и определять факторы, которые могут помочь или повредить вашему сну. Если вы проверяете новый режим сна или другие изменения гигиены сна, дневник сна может помочь зафиксировать, насколько хорошо он работает.
  • Поговорите с доктором: Врач может лучше всех дать подробный совет людям, у которых серьезные проблемы со сном.Поговорите со своим врачом, если вы обнаружите, что ваши проблемы со сном ухудшаются, сохраняются в течение длительного времени, влияют на ваше здоровье и безопасность (например, из-за чрезмерной дневной сонливости), или если они возникают вместе с другими необъяснимыми проблемами со здоровьем.
  • Была ли эта статья полезной?
  • Да Нет

Депривация сна: причины, симптомы и лечение

Почти каждый сталкивался с ощущением зомби после ночи, когда не спал или не спал.Даже после одной ночи без достаточного отдыха мы можем чувствовать сонливость в течение дня с замедленным мышлением, недостатком энергии и раздражительным настроением.

Недосыпание — это когда вы не высыпаетесь, и, по оценкам, от него страдает около одной трети взрослого населения Америки, и проблема, которая только усугубилась в последние годы.

Недостаток сна напрямую влияет на то, как мы думаем и чувствуем. Хотя краткосрочные последствия более заметны, хроническое недосыпание может повысить долгосрочный риск проблем с физическим и психическим здоровьем.

Чтобы избежать этих проблем, важно избегать недосыпания. Понимание этого состояния, включая его причины, симптомы, диагностику и лечение, поможет вам лучше высыпаться.

Что такое недосыпание?

Термин «недосыпание» означает получение меньшего количества сна, чем необходимо, которое для взрослых составляет от семи до девяти часов сна в сутки. Детям и подросткам требуется даже больше ночного сна, чем взрослым.

Все ли определения лишения сна одинаковы?

В медицине сна лишение сна определяется на основе продолжительности сна, которая представляет собой общее количество времени, которое человек проводит во сне. В действительности, однако, хорошо отдохнувший — это больше, чем просто количество часов, в течение которых вы спите. В результате термины дефицит сна или недостаточность сна чаще используются для описания факторов, которые уменьшают количество и / или качество сна и мешают человеку просыпаться отдохнувшим.

Таким образом, недостаток сна имеет более широкое применение.Например, человек, который спит в общей сложности восемь часов, но с большим количеством пробуждений, которые фрагментируют его сон, может недосыпать, даже если продолжительность его сна технически соответствует рекомендуемому количеству.

Эта терминология может отличаться от повседневного разговора, в котором термин «лишение сна» может использоваться в более широком значении, которое относится к плохому сну в целом, а не только к общей продолжительности сна.

Даже в области медицины в исследованиях могут использоваться различные технические определения депривации сна, поскольку одни классифицируют ее как семь часов сна или меньше, в то время как другие используют шесть часов в качестве порогового значения.

Существуют ли разные типы лишения сна?

Недостаток сна и недостаточность сна можно классифицировать по-разному в зависимости от обстоятельств человека.

  • Острое лишение сна относится к короткому периоду, обычно несколько дней или меньше, когда человек значительно сокращает время сна.
  • Хроническое недосыпание , также известное как синдром недостаточного сна, определяется Американской академией медицины сна как ограниченный сон, который сохраняется в течение трех месяцев или дольше.
  • Хронический дефицит сна или недостаточный сон может описывать продолжающееся лишение сна, а также плохой сон, возникающий из-за фрагментации сна или других нарушений.

Отличается ли лишение сна от бессонницы?

В то время как бессонница и недосыпание связаны с недосыпанием, многие эксперты в области науки о сне проводят различие между ними. Люди с бессонницей плохо спят, даже если у них достаточно времени для сна.С другой стороны, людям, страдающим недосыпанием, не хватает времени на сон из-за выбора поведения или повседневных обязательств.

Иллюстрацией этого различия является то, что люди, лишенные сна из-за плотного рабочего графика, обычно не имеют проблем со сном дольше по выходным, чтобы попытаться «наверстать упущенное». Тем не менее, кто-то, страдающий бессонницей, все еще не может заснуть, несмотря на возможность сделать это.

Может быть значительное совпадение между описанием депривации сна и бессонницы, но пациенты должны знать, что их врач или специалист по сну могут использовать более конкретные определения.

Что вызывает недосыпание?


Множественные факторы могут вызывать или способствовать недосыпанию, включая плохую гигиену сна, выбор образа жизни, рабочие обязанности, нарушения сна и другие заболевания.

Лишение сна часто вызвано добровольным выбором, который сокращает доступное время сна. Например, человек, решивший поздно ложиться спать, чтобы посмотреть телесериал, может испытывать острое недосыпание. Непоследовательный режим сна может облегчить принятие этих решений и сделать их менее преднамеренными в данный момент.

Рабочие обязанности — еще одна частая причина недосыпания. Людям, которые работают на нескольких работах или в течение длительного времени, может не хватать времени для достаточного сна. Сменным работникам, которым приходится работать по ночам, также может быть трудно получить необходимое количество сна.

Недостаток сна может быть вызван другими нарушениями сна или другими заболеваниями. Например, апноэ во сне, нарушение дыхания, которое вызывает десятки ночных пробуждений, может ухудшить как продолжительность, так и качество сна.Другие проблемы со здоровьем или психическим здоровьем, такие как боль или общее тревожное расстройство, могут влиять на качество и количество сна.

Каковы симптомы недосыпания?

Основные признаки и симптомы недосыпания включают чрезмерную дневную сонливость и нарушения в дневное время, такие как снижение концентрации внимания, замедленное мышление и изменения настроения.

Чувство сильной усталости в течение дня — один из отличительных признаков недосыпания. Люди с чрезмерной дневной сонливостью могут чувствовать сонливость и им трудно бодрствовать, даже когда им это необходимо.В некоторых случаях это приводит к микросону, в котором человек засыпает на несколько секунд.

Недостаток сна может напрямую повлиять на самочувствие человека в часы бодрствования. Примеры этих симптомов включают:

  • Замедленное мышление
  • Пониженная продолжительность концентрации внимания
  • Ухудшенная память
  • Принятие неверных или рискованных решений
  • Недостаток энергии
  • Изменения настроения, включая чувство стресса, беспокойства или раздражительности

Симптомы человека могут зависеть от степени недосыпания и от того, является ли оно острым или хроническим.Исследования также показывают, что некоторые люди с большей вероятностью будут испытывать симптомы после недосыпания и что это может быть связано с генетикой человека. Стимуляторы, такие как кофеин, также могут маскировать симптомы недосыпания, поэтому важно отмечать, как вы себя чувствуете после приема этих веществ и без них.

Каковы последствия недосыпания?

Последствия недосыпания и недосыпания могут быть серьезными и далеко идущими.

Острое недосыпание повышает риск непреднамеренных ошибок и несчастных случаев.Сонливое вождение, связанное с замедлением реакции и риском микросна, может быть опасным для жизни. Люди, лишенные сна, с большей вероятностью будут испытывать трудности в школе и на работе или испытывать изменения настроения, которые могут повлиять на личные отношения.

Хроническое недосыпание может способствовать широкому спектру проблем со здоровьем. Сон играет фундаментальную роль в эффективном функционировании почти всех систем организма, поэтому постоянное недосыпание создает значительные риски для физического и психического здоровья:

  • Сердечно-сосудистые заболевания: Исследования показали тесную связь между дефицитом сна и сердечно-сосудистыми проблемами, включая высокое кровяное давление, ишемическую болезнь сердца, сердечный приступ и инсульт.
  • Диабет: Недостаток сна, по-видимому, влияет на способность организма регулировать уровень сахара в крови, повышая риск метаболических состояний, таких как диабет.
  • Ожирение: Исследования показали, что люди, как правило, потребляют больше калорий и углеводов, когда не высыпаются, что является лишь одним из нескольких способов, которыми плохой сон может быть связан с ожирением и проблемами с поддержанием здорового веса.
  • Иммунодефицит: Было показано, что дефицит сна приводит к ухудшению иммунной функции, включая более слабый ответ на вакцины.
  • Гормональные нарушения: Сон помогает организму должным образом вырабатывать и регулировать уровни различных гормонов, потенциально повышая предрасположенность к гормональным проблемам у людей с недосыпанием.
  • Боль: Люди, лишенные сна, подвергаются более высокому риску развития боли или ощущения, что их боль усиливается. Боль может вызвать дальнейшие прерывания сна, создавая отрицательный цикл ухудшения боли и сна.
  • Психические расстройства: Сон и психическое здоровье тесно взаимосвязаны, а плохой сон тесно связан с такими состояниями, как депрессия, тревога и биполярное расстройство.

Учитывая эти разнообразные и важные последствия недосыпания, неудивительно, что исследования показали, что недостаточный сон связан с повышенным общим риском смерти, а также с более низким качеством жизни.

На уровне общества последствия недосыпания огромны. По оценкам CDC, 6000 смертей ежегодно вызываются сонным вождением, а недосыпание приводит к дополнительным расходам на здравоохранение в сотни миллиардов долларов, а также к потере производительности более 400 миллиардов долларов в год только в Соединенных Штатах.

Как диагностируется недосыпание?

Врачи часто могут диагностировать недосыпание, обсуждая симптомы и режим сна пациента. Это может включать просмотр дневника сна или заполнение анкеты сна, которая предлагает подробный анализ режима сна и дневных симптомов.

В некоторых случаях может проводиться дополнительное тестирование с использованием технологии отслеживания сна, известной как актиграфия, или с исследованием ночного сна, если требуется дополнительная информация или если врач подозревает, что у пациента может быть основное нарушение сна.

Как предотвратить и лечить недосыпание

Если у вас есть постоянные или усугубляющиеся проблемы из-за недостаточного сна или дневной сонливости, работа с врачом — хороший первый шаг к получению облегчения. Ваш врач может оценить вашу ситуацию и порекомендовать лечение, которое наилучшим образом соответствует вашим потребностям.

В большинстве случаев внимание к гигиене сна — среде вашего сна и повседневным привычкам — является центральным компонентом профилактики и лечения недосыпания. В следующих разделах описаны некоторые ключевые улучшения гигиены сна для людей, которые недосыпают.

Обращайтесь к лишению сна, не справляйтесь с этим

Многие люди недосыпают, потому что принимают недосыпание как нормальное явление. Вместо того, чтобы предпринимать необходимые шаги, чтобы больше спать, они пьют кофеин или энергетические напитки, дремлют или просто пытаются «выжить».

Ни один из этих подходов не является надежным решением проблемы недосыпания. Они могут помочь пережить день, но кумулятивные эффекты недосыпания по-прежнему сказываются как в краткосрочной, так и в долгосрочной перспективе.

По этой причине важно не принимать недостаток сна как нормальное явление и вместо этого сосредоточиться на том, чтобы больше спать и получать более качественный отдых.

Сделайте сон приоритетом

Хронический недостаток сна часто возникает, когда люди жертвуют сном в пользу работы, отдыха или других обязательств. Чтобы противодействовать этому, очень важно сделать так, чтобы сон стал приоритетом:

  • Имейте постоянный график сна: Вы должны стараться ложиться и вставать в одно и то же время каждый день.Планируя это время, не забудьте выделить время, чтобы выспаться. Определившись с расписанием, внимательно следите за ним, даже по выходным. Стабильность режима сна помогает избежать колебаний ночного сна.
  • Установите границы в своей работе и общественной жизни: Требования вашей личной или профессиональной жизни легко урезать выделенное вам время для сна, поэтому полезно установить границы, чтобы сохранить все время, необходимое для отдыха каждую ночь.
  • Соблюдайте распорядок дня перед сном: Будьте готовы каждую ночь с помощью одних и тех же действий, таких как тихое чтение или растяжка, надевание пижамы и чистка зубов. Регулярный распорядок дня перед сном поможет вам настроиться на хороший сон каждую ночь.

Настройте обстановку в спальне

Создайте в своей спальне идеальное место для отдыха. У вас меньше шансов избежать отхода ко сну, если режим сна удобен и соответствует вашим предпочтениям в отношении комфорта.

Матрас и подушки должны обеспечивать достаточную поддержку, а постельное белье должно помогать вам чувствовать себя уютно и поддерживать умеренную температуру. Чтобы свести к минимуму возможные нарушения сна, постарайтесь, чтобы в вашей спальне было как можно тише и темно.

Избегайте вещей, которые могут мешать сну

Полезный шаг в решении проблемы недосыпания — избегать вещей, которые могут, часто без вашего ведома, негативно повлиять на ваш сон:

  • Электронные устройства: Телевизоры, сотовые телефоны, планшеты и компьютеры могут стимулировать ваш разум, оставляя вас на связи, когда вы хотите лечь спать.Свет, излучаемый этими устройствами, также может влиять на ваш циркадный ритм. Поэтому лучше не пользоваться электронными устройствами в течение часа и более перед сном.
  • Алкоголь: Употребление алкоголя, особенно в ночное время, может нарушить ваш нормальный цикл сна, снижая общее качество и постоянство сна.
  • Кофеин: Как стимулятор, кофеин заставляет вас бодрствовать, и, поскольку он может оставаться в вашем организме в течение нескольких часов, лучше избегать его днем ​​и вечером.
  • Дневной сон: Чтобы сон не мешал спать ночью, делайте его коротким (30 минут или меньше) и никогда не делайте его поздно днем ​​или позже. Если вы боретесь с бессонницей, лучше вообще не спать.

Получите максимум удовольствия от дня

Частое пребывание на солнце в течение дня поддерживает здоровый циркадный ритм, который помогает вам быть бдительным днем ​​и сонным ночью. Регулярная физическая активность также может способствовать нормальному режиму сна, поэтому старайтесь заниматься хотя бы умеренными упражнениями каждый день.

  • Была ли эта статья полезной?
  • Да Нет
.